RchiOBHm_Chr1g0341651

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
1
Physical Location & Seq
Reverse (-)
33396613 .. 33396924
312 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ56833

Sequence Viewer

Length: 153 bp
ATGCGTTTTCCAATTTGTGATTTTTGTGATTGTTTATTGGTTAAAGTAGAGGTTTCGGAGAAGCCAAAGGCTAAAATTATTGTGCTGAAGGAGCTCTACAATCAACTCACTGAAATTGGGCGAATTGAGCTTTCGGGTTTTCGTGGAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

50

Amino Acids

5.76

Weight (kDa)

7.69

Isoelectric Point (pI)

28.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 107
AluBI AGCT 2 cut(s) 94, 130
AluI AGCT 2 cut(s) 94, 130
Alw21I GWGCWC 1 cut(s) 96
BanII GRGCYC 1 cut(s) 96
BarI GAAGNNNNNNTAC 2 cut(s) 80, 112
Bbv12I GWGCWC 1 cut(s) 96
BsiHKAI GWGCWC 1 cut(s) 96
Bsp1286I GDGCHC 1 cut(s) 96
BstMWI GCNNNNNNNGC 2 cut(s) 91, 127
BtsIMutI CAGTG 1 cut(s) 108
CviJI RGCY 4 cut(s) 64, 71, 94, 130
CviKI_1 RGCY 4 cut(s) 64, 71, 94, 130
Ecl136II GAGCTC 1 cut(s) 94
Eco24I GRGCYC 1 cut(s) 96
Eco53kI GAGCTC 1 cut(s) 94
Eco57I CTGAAG 1 cut(s) 107
EcoICRI GAGCTC 1 cut(s) 94
EcoT38I GRGCYC 1 cut(s) 96
FriOI GRGCYC 1 cut(s) 96
Hpy188I TCNGA 1 cut(s) 58
HpyAV CCTTC 1 cut(s) 82
HpyF10VI GCNNNNNNNGC 2 cut(s) 91, 127
LmnI GCTCC 1 cut(s) 91
MhlI GDGCHC 1 cut(s) 96
MluCI AATT 5 cut(s) 12, 75, 114, 123, 148
MnlI CCTC 1 cut(s) 43
MseI TTAA 1 cut(s) 42
MwoI GCNNNNNNNGC 2 cut(s) 91, 127
Psp124BI GAGCTC 1 cut(s) 96
SacI GAGCTC 1 cut(s) 96
SaqAI TTAA 1 cut(s) 42
SduI GDGCHC 1 cut(s) 96
SetI ASST 3 cut(s) 54, 96, 132
SgeI CNNG 1 cut(s) 147
Sse9I AATT 5 cut(s) 12, 75, 114, 123, 148
SstI GAGCTC 1 cut(s) 96
TasI AATT 5 cut(s) 12, 75, 114, 123, 148
Tru1I TTAA 1 cut(s) 42
Tru9I TTAA 1 cut(s) 42
TscAI CASTG 1 cut(s) 115
TspRI CASTG 1 cut(s) 115
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.