RchiOBHm_Chr4g0411411

Translin family

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
35273887 .. 35274202
316 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38222

Sequence Viewer

Length: 177 bp
ATGGAGATCGAGCCCACCACTAGGTTTATTCACTCGAGCCTCCTCTTGGTTCACCAGTCGAGTTCAACTCCCGAGGTTTTGGAGAAGCCAAAGGCTAAAATTATTGTGCTGAAGGAGCTCTACAATCAACTCGCTGAAATTGTGCGAATTGAGCTTTCGGGTTTCCGTGGAAATTGA
Functional Annotation
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

58

Amino Acids

6.6

Weight (kDa)

6.72

Isoelectric Point (pI)

46.22

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 131
AfiI CCNNNNNNNGG 2 cut(s) 21, 46
AgsI TTSAA 1 cut(s) 66
AluBI AGCT 2 cut(s) 118, 154
AluI AGCT 2 cut(s) 118, 154
Alw21I GWGCWC 1 cut(s) 120
Ama87I CYCGRG 2 cut(s) 34, 71
AsuHPI GGTGA 1 cut(s) 44
AvaI CYCGRG 2 cut(s) 34, 71
BanII GRGCYC 2 cut(s) 15, 120
BarI GAAGNNNNNNTAC 2 cut(s) 104, 136
Bbv12I GWGCWC 1 cut(s) 120
BfaI CTAG 1 cut(s) 21
BmeT110I CYCGRG 2 cut(s) 34, 71
BplI GAGNNNNNCTC 2 cut(s) 52, 84
BsaJI CCNNGG 2 cut(s) 72, 166
Bsc4I CCNNNNNNNGG 2 cut(s) 21, 46
Bse1I ACTGG 1 cut(s) 55
BseDI CCNNGG 2 cut(s) 72, 166
BseLI CCNNNNNNNGG 2 cut(s) 21, 46
BseNI ACTGG 1 cut(s) 55
BseRI GAGGAG 1 cut(s) 32
BsiHKAI GWGCWC 1 cut(s) 120
BsiHKCI CYCGRG 2 cut(s) 34, 71
BslI CCNNNNNNNGG 2 cut(s) 21, 46
BsoBI CYCGRG 2 cut(s) 34, 71
Bsp1286I GDGCHC 2 cut(s) 15, 120
Bsp143I GATC 1 cut(s) 6
BsrI ACTGG 1 cut(s) 55
BssECI CCNNGG 2 cut(s) 72, 166
BssMI GATC 1 cut(s) 6
BstDSI CCRYGG 1 cut(s) 166
BstKTI GATC 1 cut(s) 9
BstMBI GATC 1 cut(s) 6
BstMWI GCNNNNNNNGC 2 cut(s) 115, 151
BtgI CCRYGG 1 cut(s) 166
CviJI RGCY 6 cut(s) 13, 39, 88, 95, 118, 154
CviKI_1 RGCY 6 cut(s) 13, 39, 88, 95, 118, 154
DpnI GATC 1 cut(s) 8
DpnII GATC 1 cut(s) 6
Ecl136II GAGCTC 1 cut(s) 118
Eco24I GRGCYC 2 cut(s) 15, 120
Eco53kI GAGCTC 1 cut(s) 118
Eco57I CTGAAG 1 cut(s) 131
Eco88I CYCGRG 2 cut(s) 34, 71
EcoICRI GAGCTC 1 cut(s) 118
EcoT38I GRGCYC 2 cut(s) 15, 120
FriOI GRGCYC 2 cut(s) 15, 120
FspBI CTAG 1 cut(s) 21
HphI GGTGA 1 cut(s) 44
Hpy166II GTNNAC 1 cut(s) 52
Hpy188III TCNNGA 1 cut(s) 71
Hpy8I GTNNAC 1 cut(s) 52
HpyAV CCTTC 1 cut(s) 106
HpyF10VI GCNNNNNNNGC 2 cut(s) 115, 151
Kzo9I GATC 1 cut(s) 6
LmnI GCTCC 1 cut(s) 115
LpnPI CCDG 1 cut(s) 68
MaeI CTAG 1 cut(s) 21
MalI GATC 1 cut(s) 8
MboI GATC 1 cut(s) 6
MhlI GDGCHC 2 cut(s) 15, 120
MluCI AATT 4 cut(s) 99, 138, 147, 172
MnlI CCTC 3 cut(s) 50, 53, 67
MwoI GCNNNNNNNGC 2 cut(s) 115, 151
NdeII GATC 1 cut(s) 6
PaeR7I CTCGAG 1 cut(s) 34
Psp124BI GAGCTC 1 cut(s) 120
PspXI VCTCGAGB 1 cut(s) 34
SacI GAGCTC 1 cut(s) 120
Sau3AI GATC 1 cut(s) 6
SduI GDGCHC 2 cut(s) 15, 120
SetI ASST 4 cut(s) 26, 78, 120, 156
Sfr274I CTCGAG 1 cut(s) 34
SlaI CTCGAG 1 cut(s) 34
SmlI CTYRAG 1 cut(s) 34
SmoI CTYRAG 1 cut(s) 34
Sse9I AATT 4 cut(s) 99, 138, 147, 172
SspMI CTAG 1 cut(s) 21
SstI GAGCTC 1 cut(s) 120
TaqI TCGA 3 cut(s) 9, 35, 59
TasI AATT 4 cut(s) 99, 138, 147, 172
TspGWI ACGGA 1 cut(s) 155
XhoI CTCGAG 1 cut(s) 34
XspI CTAG 1 cut(s) 21
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.