RchiOBHm_Chr2g0131821

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
48179307 .. 48179962
656 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ50312

Sequence Viewer

Length: 177 bp
ATGGAGTTGATTTTTGGGGTCAGGTTACATCATATGACGCTTGACGATTTGCCGAATGGTATTATGGATGAGGTATTTTTCTACACATTATTTTGTAAATGTCATGTTTGGATTTCTTACAGAATTGAATGCATGTGTTGCTACTTGCTAGATAAAACTTCACAGTGCAAAATTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.97

Weight (kDa)

5.78

Isoelectric Point (pI)

35.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 171
AgsI TTSAA 1 cut(s) 128
ApoI RAATTY 1 cut(s) 171
BfaI CTAG 1 cut(s) 149
BseGI GGATG 1 cut(s) 73
BsmI GAATGC 1 cut(s) 134
Bst4CI ACNGT 1 cut(s) 165
BstAPI GCANNNNNTGC 1 cut(s) 138
BstF5I GGATG 1 cut(s) 73
BstMWI GCNNNNNNNGC 1 cut(s) 138
BstNSI RCATGY 1 cut(s) 136
BtsCI GGATG 1 cut(s) 73
BtsIMutI CAGTG 1 cut(s) 170
CseI GACGC 1 cut(s) 46
CviAII CATG 2 cut(s) 104, 133
EcoT22I ATGCAT 1 cut(s) 134
FaeI CATG 2 cut(s) 107, 136
FaiI YATR 5 cut(s) 33, 35, 65, 105, 134
FatI CATG 2 cut(s) 103, 132
FauNDI CATATG 1 cut(s) 33
FokI GGATG 1 cut(s) 80
FspBI CTAG 1 cut(s) 149
FspEI CC 7 cut(s) 2, 7, 42, 50, 56, 66, 94
HgaI GACGC 1 cut(s) 46
Hin1II CATG 2 cut(s) 107, 136
HpyCH4III ACNGT 1 cut(s) 165
HpyCH4V TGCA 2 cut(s) 132, 168
HpyF10VI GCNNNNNNNGC 1 cut(s) 138
Hsp92II CATG 2 cut(s) 107, 136
LpnPI CCDG 1 cut(s) 7
MaeI CTAG 1 cut(s) 149
MaeIII GTNAC 1 cut(s) 24
MluCI AATT 2 cut(s) 123, 171
MnlI CCTC 1 cut(s) 64
Mph1103I ATGCAT 1 cut(s) 134
MseI TTAA 1 cut(s) 175
Mva1269I GAATGC 1 cut(s) 134
MwoI GCNNNNNNNGC 1 cut(s) 138
NdeI CATATG 1 cut(s) 33
NlaIII CATG 2 cut(s) 107, 136
NsiI ATGCAT 1 cut(s) 134
NspI RCATGY 1 cut(s) 136
PctI GAATGC 1 cut(s) 134
SaqAI TTAA 1 cut(s) 175
SetI ASST 2 cut(s) 26, 75
SgeI CNNG 6 cut(s) 34, 53, 116, 145, 157, 161
Sse9I AATT 2 cut(s) 123, 171
SspMI CTAG 1 cut(s) 149
TaaI ACNGT 1 cut(s) 165
TasI AATT 2 cut(s) 123, 171
Tru1I TTAA 1 cut(s) 175
Tru9I TTAA 1 cut(s) 175
TscAI CASTG 1 cut(s) 170
TspRI CASTG 1 cut(s) 170
XapI RAATTY 1 cut(s) 171
XceI RCATGY 1 cut(s) 136
XspI CTAG 1 cut(s) 149
Zsp2I ATGCAT 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.