Rh3CG255600
ERF Family

Belongs to the class I-like SAM-binding methyltransferase superfamily. RsmB NOP family

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Forward (+)
24959420 .. 24962198
2779 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG255600.1

Sequence Viewer

Length: 330 bp
ATGCAAGTAAAAGGTGATTTCTTGAAGGGCAGAGCAAATCTTAAGATAATCGAACAGGTATTGAAGGTTATCAACATTTTGAATAGCAAGTGGAGGAAGCCAGATGAGTTGGTTCACATTGCCACCTATGTTATTCTTTTCGGCCAGGTTCGAAAAGATGATCTGGTTCCAGACTTGTTTATTCTTCCGCCTGGGTTTGAGTTGCATGACCATCCTCTATTAACCGTTTATTGCTCTCTGCTACGTTCTGAAGTGTTGCAGGTTGTTGTTCACCAACCATTAAATAAGGTAGACAAACCTTCATATTTGAAAATAGATATCGATCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

109

Amino Acids

12.58

Weight (kDa)

7.88

Isoelectric Point (pI)

32.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 250
AccI GTMKAC 1 cut(s) 291
AciI CCGC 1 cut(s) 188
AcoI YGGCCR 1 cut(s) 142
AcuI CTGAAG 1 cut(s) 270
AflII CTTAAG 1 cut(s) 41
AgsI TTSAA 4 cut(s) 25, 64, 82, 310
AjnI CCWGG 2 cut(s) 144, 190
AoxI GGCC 1 cut(s) 142
AsuHPI GGTGA 2 cut(s) 26, 263
AsuII TTCGAA 1 cut(s) 151
BccI CCATC 1 cut(s) 219
BciT130I CCWGG 2 cut(s) 146, 192
BfrI CTTAAG 1 cut(s) 41
BfuAI ACCTGC 1 cut(s) 250
Bme1390I CCNGG 2 cut(s) 146, 192
BmiI GGNNCC 1 cut(s) 168
BmrFI CCNGG 2 cut(s) 146, 192
Bpu14I TTCGAA 1 cut(s) 151
Bsa29I ATCGAT 1 cut(s) 321
BsaBI GATNNNNATC 1 cut(s) 321
BsaJI CCNNGG 1 cut(s) 191
Bse3DI GCAATG 1 cut(s) 117
Bse8I GATNNNNATC 1 cut(s) 321
BseBI CCWGG 2 cut(s) 146, 192
BseCI ATCGAT 1 cut(s) 321
BseDI CCNNGG 1 cut(s) 191
BseGI GGATG 1 cut(s) 211
BseJI GATNNNNATC 1 cut(s) 321
BseMI GCAATG 1 cut(s) 117
BshFI GGCC 1 cut(s) 144
BshVI ATCGAT 1 cut(s) 321
BsnI GGCC 1 cut(s) 144
Bsp119I TTCGAA 1 cut(s) 151
Bsp143I GATC 2 cut(s) 160, 322
BspACI CCGC 1 cut(s) 188
BspANI GGCC 1 cut(s) 144
BspDI ATCGAT 1 cut(s) 321
BspLI GGNNCC 1 cut(s) 168
BspMI ACCTGC 1 cut(s) 250
BspT104I TTCGAA 1 cut(s) 151
BspTI CTTAAG 1 cut(s) 41
BsrDI GCAATG 1 cut(s) 117
BssECI CCNNGG 1 cut(s) 191
BssMI GATC 2 cut(s) 160, 322
Bst2UI CCWGG 2 cut(s) 146, 192
Bst4CI ACNGT 1 cut(s) 226
BstAFI CTTAAG 1 cut(s) 41
BstBI TTCGAA 1 cut(s) 151
BstF5I GGATG 1 cut(s) 211
BstKTI GATC 2 cut(s) 163, 325
BstMBI GATC 2 cut(s) 160, 322
BstNI CCWGG 2 cut(s) 146, 192
BstSCI CCNGG 2 cut(s) 144, 190
Bsu15I ATCGAT 1 cut(s) 321
BsuRI GGCC 1 cut(s) 144
BsuTUI ATCGAT 1 cut(s) 321
BtsCI GGATG 1 cut(s) 211
BveI ACCTGC 1 cut(s) 250
ClaI ATCGAT 1 cut(s) 321
CviAII CATG 1 cut(s) 206
CviJI RGCY 2 cut(s) 100, 144
CviKI_1 RGCY 2 cut(s) 100, 144
DpnI GATC 2 cut(s) 162, 324
DpnII GATC 2 cut(s) 160, 322
EaeI YGGCCR 1 cut(s) 142
EciI GGCGGA 1 cut(s) 177
Eco32I GATATC 1 cut(s) 319
Eco57I CTGAAG 1 cut(s) 270
EcoRII CCWGG 2 cut(s) 144, 190
EcoRV GATATC 1 cut(s) 319
FaeI CATG 1 cut(s) 209
FaiI YATR 3 cut(s) 129, 207, 304
FatI CATG 1 cut(s) 205
FblI GTMKAC 1 cut(s) 291
FokI GGATG 1 cut(s) 198
HaeIII GGCC 1 cut(s) 144
Hin1II CATG 1 cut(s) 209
HphI GGTGA 2 cut(s) 26, 263
Hpy166II GTNNAC 3 cut(s) 115, 271, 292
Hpy188I TCNGA 1 cut(s) 250
Hpy188III TCNNGA 2 cut(s) 22, 170
Hpy8I GTNNAC 3 cut(s) 115, 271, 292
HpyAV CCTTC 3 cut(s) 19, 58, 309
HpyCH4III ACNGT 1 cut(s) 226
HpyCH4IV ACGT 1 cut(s) 244
HpyCH4V TGCA 3 cut(s) 4, 205, 259
HpySE526I ACGT 1 cut(s) 244
Hsp92II CATG 1 cut(s) 209
Kzo9I GATC 2 cut(s) 160, 322
LpnPI CCDG 9 cut(s) 41, 114, 131, 149, 158, 177, 183, 204, 245
MaeII ACGT 1 cut(s) 244
MalI GATC 2 cut(s) 162, 324
MboI GATC 2 cut(s) 160, 322
MboII GAAGA 1 cut(s) 176
MnlI CCTC 2 cut(s) 87, 225
MseI TTAA 3 cut(s) 42, 221, 281
MspCI CTTAAG 1 cut(s) 41
MspR9I CCNGG 2 cut(s) 146, 192
MvaI CCWGG 2 cut(s) 146, 192
NdeII GATC 2 cut(s) 160, 322
NlaIII CATG 1 cut(s) 209
NlaIV GGNNCC 1 cut(s) 168
NspV TTCGAA 1 cut(s) 151
Psp6I CCWGG 2 cut(s) 144, 190
PspGI CCWGG 2 cut(s) 144, 190
PspN4I GGNNCC 1 cut(s) 168
SaqAI TTAA 3 cut(s) 42, 221, 281
Sau3AI GATC 2 cut(s) 160, 322
ScrFI CCNGG 2 cut(s) 146, 192
SetI ASST 9 cut(s) 16, 60, 69, 128, 150, 247, 264, 291, 301
SfuI TTCGAA 1 cut(s) 151
SmlI CTYRAG 1 cut(s) 41
SmoI CTYRAG 1 cut(s) 41
SsiI CCGC 1 cut(s) 188
StyD4I CCNGG 2 cut(s) 144, 190
TaaI ACNGT 1 cut(s) 226
TaiI ACGT 1 cut(s) 247
TaqI TCGA 3 cut(s) 51, 151, 321
Tru1I TTAA 3 cut(s) 42, 221, 281
Tru9I TTAA 3 cut(s) 42, 221, 281
TspDTI ATGAA 1 cut(s) 291
Vha464I CTTAAG 1 cut(s) 41
XmiI GTMKAC 1 cut(s) 291
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.