Rh5DG473500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Forward (+)
74807577 .. 74809359
1783 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG473500.1

Sequence Viewer

Length: 222 bp
ATGGAAATTGGATTGCAAGAATTCTTGCGCGAAAGGCAAAGAATCGGTATTCTTGGAAAGGATTTGGGGCAATCTCTAATGCTATACAGGAGCTTAAGCAATGTGGAAGCTACTGCGTTCTGCAAAGATAGCTATAGAGAAAAGGTTGATACAGGTGGGCAAATGTCTGACAGCATTTTCATTGCTCATAGAAGAGCAAAAGGTATTACAAGACCACAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

73

Amino Acids

8.32

Weight (kDa)

9.42

Isoelectric Point (pI)

48.78

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 30
AcsI RAATTY 1 cut(s) 20
AflII CTTAAG 1 cut(s) 94
AluBI AGCT 3 cut(s) 93, 110, 132
AluI AGCT 3 cut(s) 93, 110, 132
ApoI RAATTY 1 cut(s) 20
AspLEI GCGC 1 cut(s) 30
BfmI CTRYAG 1 cut(s) 133
BfrI CTTAAG 1 cut(s) 94
Bse3DI GCAATG 2 cut(s) 106, 180
BseMI GCAATG 2 cut(s) 106, 180
Bsh1236I CGCG 1 cut(s) 30
BspFNI CGCG 1 cut(s) 30
BspQI GCTCTTC 1 cut(s) 187
BspTI CTTAAG 1 cut(s) 94
BsrDI GCAATG 2 cut(s) 106, 180
Bst4CI ACNGT 1 cut(s) 219
Bst6I CTCTTC 1 cut(s) 187
BstAFI CTTAAG 1 cut(s) 94
BstFNI CGCG 1 cut(s) 30
BstHHI GCGC 1 cut(s) 30
BstMWI GCNNNNNNNGC 2 cut(s) 34, 129
BstSFI CTRYAG 1 cut(s) 133
BstUI CGCG 1 cut(s) 30
CfoI GCGC 1 cut(s) 30
CviJI RGCY 3 cut(s) 93, 110, 132
CviKI_1 RGCY 3 cut(s) 93, 110, 132
Eam1104I CTCTTC 1 cut(s) 187
EarI CTCTTC 1 cut(s) 187
EcoRI GAATTC 1 cut(s) 20
FaiI YATR 3 cut(s) 85, 135, 189
GlaI GCGC 1 cut(s) 29
HhaI GCGC 1 cut(s) 30
Hin6I GCGC 1 cut(s) 28
HinP1I GCGC 1 cut(s) 28
HinfI GANTC 1 cut(s) 42
Hpy188I TCNGA 1 cut(s) 169
HpyCH4III ACNGT 1 cut(s) 219
HpyCH4V TGCA 2 cut(s) 16, 123
HpyF10VI GCNNNNNNNGC 2 cut(s) 34, 129
HspAI GCGC 1 cut(s) 28
LguI GCTCTTC 1 cut(s) 187
LmnI GCTCC 1 cut(s) 90
LpnPI CCDG 2 cut(s) 73, 138
MboII GAAGA 1 cut(s) 204
MluCI AATT 2 cut(s) 6, 20
MseI TTAA 1 cut(s) 95
MspCI CTTAAG 1 cut(s) 94
MvnI CGCG 1 cut(s) 30
MwoI GCNNNNNNNGC 2 cut(s) 34, 129
PciSI GCTCTTC 1 cut(s) 187
PfeI GAWTC 1 cut(s) 42
SapI GCTCTTC 1 cut(s) 187
SaqAI TTAA 1 cut(s) 95
SetI ASST 6 cut(s) 95, 112, 134, 147, 157, 205
SfcI CTRYAG 1 cut(s) 133
SgeI CNNG 6 cut(s) 29, 37, 41, 65, 100, 165
SmlI CTYRAG 1 cut(s) 94
SmoI CTYRAG 1 cut(s) 94
Sse9I AATT 2 cut(s) 6, 20
TaaI ACNGT 1 cut(s) 219
TasI AATT 2 cut(s) 6, 20
TfiI GAWTC 1 cut(s) 42
Tru1I TTAA 1 cut(s) 95
Tru9I TTAA 1 cut(s) 95
TspDTI ATGAA 1 cut(s) 169
Vha464I CTTAAG 1 cut(s) 94
XapI RAATTY 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.