Rh5AG535000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5A
Physical Location & Seq
Reverse (-)
91779740 .. 91780549
810 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5AG535000.1

Sequence Viewer

Length: 432 bp
ATGCTTGGAAAATGTAGTGTGATGACTAGAGGAATGACGAGTGTGTTAGAGCAATCTGCTGCTGAAAGTAATCAAACTGGAGATAAATGTGATCAAGTTAGATCAAGGACATGCAAAAGAATGTCTCATGTAGAGTTTGGTCAAGCATCAAATCAATGTCAAAACGTCAGCAGCCAAACCGGTACTCAGGTTGCTCATGGAGATGCAGATACATTACCGGATTCAAATCAAAGCAATTCTGCCCAAGATATAGAGAGTAATAATATGAGAGATCGTCTTTTTAGTCCTGTCTCCAAAAAAGCTTCAGCCAAGTTGTTCAGCCGTAAAGTTCCAATTAAAAAAAAGAAAGAAAAAAAAGAAGGCAAAGTTCATAAGTCCAAGATTTACGGCAATGATTTACTACAGTTAATCAGGAAGCTAGAACATTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

143

Amino Acids

15.93

Weight (kDa)

9.63

Isoelectric Point (pI)

36.56

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 1 cut(s) 288
AfaI GTAC 1 cut(s) 184
AgeI ACCGGT 1 cut(s) 179
AgsI TTSAA 1 cut(s) 225
AluBI AGCT 2 cut(s) 302, 418
AluI AGCT 2 cut(s) 302, 418
Alw26I GTCTC 2 cut(s) 129, 295
ApeKI GCWGC 2 cut(s) 59, 171
AsiGI ACCGGT 1 cut(s) 179
BaeI ACNNNNGTAYC 2 cut(s) 174, 207
BbvI GCAGC 2 cut(s) 46, 183
BceAI ACGGC 2 cut(s) 306, 403
BclI TGATCA 1 cut(s) 91
BcoDI GTCTC 2 cut(s) 129, 295
BfaI CTAG 2 cut(s) 27, 419
BfmI CTRYAG 1 cut(s) 401
BisI GCNGC 2 cut(s) 60, 172
BlsI GCNGC 2 cut(s) 61, 173
BmsI GCATC 2 cut(s) 155, 193
BpmI CTGGAG 1 cut(s) 99
BsaBI GATNNNNATC 1 cut(s) 225
BsaWI WCCGGW 2 cut(s) 179, 217
Bse118I RCCGGY 1 cut(s) 179
Bse1I ACTGG 1 cut(s) 82
Bse3DI GCAATG 1 cut(s) 397
Bse8I GATNNNNATC 1 cut(s) 225
BseJI GATNNNNATC 1 cut(s) 225
BseMI GCAATG 1 cut(s) 397
BseMII CTCAG 1 cut(s) 200
BseNI ACTGG 1 cut(s) 82
BseXI GCAGC 2 cut(s) 46, 183
BshTI ACCGGT 1 cut(s) 179
BsiSI CCGG 2 cut(s) 180, 218
BsmAI GTCTC 2 cut(s) 129, 295
Bsp143I GATC 3 cut(s) 91, 101, 271
BspCNI CTCAG 1 cut(s) 199
BsrDI GCAATG 1 cut(s) 397
BsrFI RCCGGY 1 cut(s) 179
BsrI ACTGG 1 cut(s) 82
BssAI RCCGGY 1 cut(s) 179
BssMI GATC 3 cut(s) 91, 101, 271
Bst4CI ACNGT 1 cut(s) 405
BstDEI CTNAG 1 cut(s) 186
BstKTI GATC 3 cut(s) 94, 104, 274
BstMAI GTCTC 2 cut(s) 129, 295
BstMBI GATC 3 cut(s) 91, 101, 271
BstNSI RCATGY 1 cut(s) 114
BstSFI CTRYAG 1 cut(s) 401
BstV1I GCAGC 2 cut(s) 46, 183
Cfr10I RCCGGY 1 cut(s) 179
Csp6I GTAC 1 cut(s) 183
CspAI ACCGGT 1 cut(s) 179
CviAII CATG 3 cut(s) 111, 128, 197
CviJI RGCY 5 cut(s) 174, 302, 308, 321, 418
CviKI_1 RGCY 5 cut(s) 174, 302, 308, 321, 418
CviQI GTAC 1 cut(s) 183
DdeI CTNAG 1 cut(s) 186
DpnI GATC 3 cut(s) 93, 103, 273
DpnII GATC 3 cut(s) 91, 101, 271
Eco57I CTGAAG 1 cut(s) 288
FaeI CATG 3 cut(s) 114, 131, 200
FaiI YATR 6 cut(s) 112, 129, 198, 251, 266, 372
FatI CATG 3 cut(s) 110, 127, 196
FbaI TGATCA 1 cut(s) 91
Fnu4HI GCNGC 2 cut(s) 60, 172
Fsp4HI GCNGC 2 cut(s) 60, 172
FspBI CTAG 2 cut(s) 27, 419
GluI GCNGC 2 cut(s) 60, 172
GsuI CTGGAG 1 cut(s) 99
HapII CCGG 2 cut(s) 180, 218
Hin1II CATG 3 cut(s) 114, 131, 200
HindIII AAGCTT 1 cut(s) 300
HinfI GANTC 1 cut(s) 221
HpaII CCGG 2 cut(s) 180, 218
Hpy188III TCNNGA 1 cut(s) 412
HpyAV CCTTC 1 cut(s) 353
HpyCH4III ACNGT 1 cut(s) 405
HpyCH4IV ACGT 1 cut(s) 165
HpyCH4V TGCA 2 cut(s) 114, 206
HpyF3I CTNAG 1 cut(s) 186
HpySE526I ACGT 1 cut(s) 165
Hsp92II CATG 3 cut(s) 114, 131, 200
Ksp22I TGATCA 1 cut(s) 91
Kzo9I GATC 3 cut(s) 91, 101, 271
LpnPI CCDG 6 cut(s) 63, 173, 193, 231, 300, 397
Lsp1109I GCAGC 2 cut(s) 46, 183
LweI GCATC 2 cut(s) 155, 193
MaeI CTAG 2 cut(s) 27, 419
MaeII ACGT 1 cut(s) 165
MalI GATC 3 cut(s) 93, 103, 273
MboI GATC 3 cut(s) 91, 101, 271
MluCI AATT 2 cut(s) 235, 333
MnlI CCTC 1 cut(s) 23
MseI TTAA 3 cut(s) 336, 407, 430
MslI CAYNNNNRTG 1 cut(s) 201
MspI CCGG 2 cut(s) 180, 218
NdeII GATC 3 cut(s) 91, 101, 271
NlaIII CATG 3 cut(s) 114, 131, 200
NspI RCATGY 1 cut(s) 114
PfeI GAWTC 1 cut(s) 221
PinAI ACCGGT 1 cut(s) 179
PkrI GCNGC 2 cut(s) 61, 173
RsaI GTAC 1 cut(s) 184
RsaNI GTAC 1 cut(s) 183
RseI CAYNNNNRTG 1 cut(s) 201
SaqAI TTAA 3 cut(s) 336, 407, 430
SatI GCNGC 2 cut(s) 60, 172
Sau3AI GATC 3 cut(s) 91, 101, 271
SetI ASST 4 cut(s) 168, 192, 304, 420
SfaNI GCATC 2 cut(s) 155, 193
SfcI CTRYAG 1 cut(s) 401
SmiMI CAYNNNNRTG 1 cut(s) 201
Sse9I AATT 2 cut(s) 235, 333
SspMI CTAG 2 cut(s) 27, 419
TaaI ACNGT 1 cut(s) 405
TaiI ACGT 1 cut(s) 168
TasI AATT 2 cut(s) 235, 333
TfiI GAWTC 1 cut(s) 221
Tru1I TTAA 3 cut(s) 336, 407, 430
Tru9I TTAA 3 cut(s) 336, 407, 430
TseI GCWGC 2 cut(s) 59, 171
TspDTI ATGAA 1 cut(s) 359
XceI RCATGY 1 cut(s) 114
XspI CTAG 2 cut(s) 27, 419
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.