Rh5DG090700

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
8207087 .. 8208301
1215 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG090700.1

Sequence Viewer

Length: 210 bp
ATGCTCTCTCGCCCTCTCTTTCTTCTCGTCGAGATCGCCAACGACTGGAAGGGTCAAGCTCACCGTCCAGATCGATGGCCAAGGAAGAGATTGTCATCAGTCTCCTTGTATTTGTTGAAGGGCAGAGCAAATCTTAAGATAATCGAACAGGTATTGAAGGCTGTCAACGTTCTGAATAGCAAGTGGAGGAAGCCAGATGAGTTGGTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

69

Amino Acids

8.11

Weight (kDa)

10.7

Isoelectric Point (pI)

30.83

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 45
AclI AACGTT 1 cut(s) 168
AcoI YGGCCR 1 cut(s) 77
AfiI CCNNNNNNNGG 1 cut(s) 45
AflII CTTAAG 1 cut(s) 134
AgsI TTSAA 2 cut(s) 118, 157
AluBI AGCT 1 cut(s) 59
AluI AGCT 1 cut(s) 59
Alw26I GTCTC 1 cut(s) 106
AoxI GGCC 1 cut(s) 77
AsuHPI GGTGA 1 cut(s) 53
BalI TGGCCA 1 cut(s) 79
BccI CCATC 1 cut(s) 69
BcoDI GTCTC 1 cut(s) 106
BfrI CTTAAG 1 cut(s) 134
Bsa29I ATCGAT 1 cut(s) 73
BsaBI GATNNNNATC 1 cut(s) 94
BsaJI CCNNGG 1 cut(s) 80
Bsc4I CCNNNNNNNGG 1 cut(s) 45
Bse1I ACTGG 1 cut(s) 50
Bse8I GATNNNNATC 1 cut(s) 94
BseCI ATCGAT 1 cut(s) 73
BseDI CCNNGG 1 cut(s) 80
BseJI GATNNNNATC 1 cut(s) 94
BseLI CCNNNNNNNGG 1 cut(s) 45
BseNI ACTGG 1 cut(s) 50
BshFI GGCC 1 cut(s) 79
BshVI ATCGAT 1 cut(s) 73
BslI CCNNNNNNNGG 1 cut(s) 45
BsmAI GTCTC 1 cut(s) 106
BsnI GGCC 1 cut(s) 79
Bsp143I GATC 2 cut(s) 33, 70
BspANI GGCC 1 cut(s) 79
BspDI ATCGAT 1 cut(s) 73
BspTI CTTAAG 1 cut(s) 134
BsrI ACTGG 1 cut(s) 50
BssECI CCNNGG 1 cut(s) 80
BssMI GATC 2 cut(s) 33, 70
BssT1I CCWWGG 1 cut(s) 80
Bst4CI ACNGT 1 cut(s) 65
Bst6I CTCTTC 1 cut(s) 80
BstAFI CTTAAG 1 cut(s) 134
BstKTI GATC 2 cut(s) 36, 73
BstMAI GTCTC 1 cut(s) 106
BstMBI GATC 2 cut(s) 33, 70
BstXI CCANNNNNNTGG 1 cut(s) 75
Bsu15I ATCGAT 1 cut(s) 73
BsuRI GGCC 1 cut(s) 79
BsuTUI ATCGAT 1 cut(s) 73
ClaI ATCGAT 1 cut(s) 73
CviJI RGCY 4 cut(s) 59, 79, 161, 193
CviKI_1 RGCY 4 cut(s) 59, 79, 161, 193
DpnI GATC 2 cut(s) 35, 72
DpnII GATC 2 cut(s) 33, 70
EaeI YGGCCR 1 cut(s) 77
Eam1104I CTCTTC 1 cut(s) 80
EarI CTCTTC 1 cut(s) 80
Eco130I CCWWGG 1 cut(s) 80
EcoT14I CCWWGG 1 cut(s) 80
ErhI CCWWGG 1 cut(s) 80
HaeIII GGCC 1 cut(s) 79
HincII GTYRAC 1 cut(s) 166
HindII GTYRAC 1 cut(s) 166
HphI GGTGA 1 cut(s) 53
Hpy166II GTNNAC 1 cut(s) 166
Hpy188I TCNGA 1 cut(s) 174
Hpy188III TCNNGA 2 cut(s) 31, 68
Hpy8I GTNNAC 1 cut(s) 166
Hpy99I CGWCG 1 cut(s) 32
HpyAV CCTTC 3 cut(s) 43, 112, 151
HpyCH4III ACNGT 1 cut(s) 65
HpyCH4IV ACGT 1 cut(s) 168
HpySE526I ACGT 1 cut(s) 168
Kzo9I GATC 2 cut(s) 33, 70
LpnPI CCDG 3 cut(s) 31, 81, 134
MaeII ACGT 1 cut(s) 168
MalI GATC 2 cut(s) 35, 72
MboI GATC 2 cut(s) 33, 70
MboII GAAGA 2 cut(s) 14, 97
MlsI TGGCCA 1 cut(s) 79
MluNI TGGCCA 1 cut(s) 79
MnlI CCTC 2 cut(s) 24, 180
Mox20I TGGCCA 1 cut(s) 79
MscI TGGCCA 1 cut(s) 79
MseI TTAA 1 cut(s) 135
Msp20I TGGCCA 1 cut(s) 79
MspCI CTTAAG 1 cut(s) 134
NdeII GATC 2 cut(s) 33, 70
PflMI CCANNNNNTGG 1 cut(s) 45
Psp1406I AACGTT 1 cut(s) 168
SaqAI TTAA 1 cut(s) 135
Sau3AI GATC 2 cut(s) 33, 70
SetI ASST 3 cut(s) 61, 153, 171
SmlI CTYRAG 1 cut(s) 134
SmoI CTYRAG 1 cut(s) 134
StyI CCWWGG 1 cut(s) 80
TaaI ACNGT 1 cut(s) 65
TaiI ACGT 1 cut(s) 171
TaqI TCGA 3 cut(s) 30, 73, 144
Tru1I TTAA 1 cut(s) 135
Tru9I TTAA 1 cut(s) 135
Van91I CCANNNNNTGG 1 cut(s) 45
Vha464I CTTAAG 1 cut(s) 134
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.