Rh1AG256800

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1A
Physical Location & Seq
Forward (+)
47464302 .. 47478999
14698 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1AG256800.1

Sequence Viewer

Length: 201 bp
ATGAAGGAAAGAATAGAAGACATTGGGGGAGGAAGACTACAAGAGGACAATGTCAAGTTTCTTATATTAGGGAGCTTGTTTACTGTTTCCGGCCAATCAAAGACCTTGCTGAGGCTCCAAAAAAGCTTTAGCCAAGTTCATAAGTTCAAGATTTACGGCAAGGATTTACTACAGTTAATCAGGAAGCTAAAGCATTATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

7.69

Weight (kDa)

10.07

Isoelectric Point (pI)

59.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 91
AfiI CCNNNNNNNGG 1 cut(s) 111
AgsI TTSAA 1 cut(s) 148
AluBI AGCT 3 cut(s) 75, 126, 187
AluI AGCT 3 cut(s) 75, 126, 187
AoxI GGCC 1 cut(s) 91
BbsI GAAGAC 2 cut(s) 24, 40
BbvCI CCTCAGC 1 cut(s) 110
BceAI ACGGC 1 cut(s) 172
BfmI CTRYAG 1 cut(s) 170
BmiI GGNNCC 1 cut(s) 116
BpiI GAAGAC 2 cut(s) 24, 40
Bpu10I CCTNAGC 1 cut(s) 110
Bsc4I CCNNNNNNNGG 1 cut(s) 111
BseLI CCNNNNNNNGG 1 cut(s) 111
BseMII CTCAG 1 cut(s) 101
BshFI GGCC 1 cut(s) 93
BsiSI CCGG 1 cut(s) 90
BslI CCNNNNNNNGG 1 cut(s) 111
BsnI GGCC 1 cut(s) 93
BspANI GGCC 1 cut(s) 93
BspCNI CTCAG 1 cut(s) 102
BspLI GGNNCC 1 cut(s) 116
Bst4CI ACNGT 2 cut(s) 85, 174
BstDEI CTNAG 1 cut(s) 110
BstENI CCTNNNNNAGG 1 cut(s) 109
BstSFI CTRYAG 1 cut(s) 170
BstV2I GAAGAC 2 cut(s) 24, 40
BsuRI GGCC 1 cut(s) 93
CviJI RGCY 6 cut(s) 75, 93, 115, 126, 132, 187
CviKI_1 RGCY 6 cut(s) 75, 93, 115, 126, 132, 187
DdeI CTNAG 1 cut(s) 110
EaeI YGGCCR 1 cut(s) 91
EcoNI CCTNNNNNAGG 1 cut(s) 109
FaiI YATR 2 cut(s) 65, 141
HaeIII GGCC 1 cut(s) 93
HapII CCGG 1 cut(s) 90
HindIII AAGCTT 1 cut(s) 124
HpaII CCGG 1 cut(s) 90
Hpy166II GTNNAC 1 cut(s) 81
Hpy188III TCNNGA 2 cut(s) 148, 181
Hpy8I GTNNAC 1 cut(s) 81
HpyCH4III ACNGT 2 cut(s) 85, 174
HpyF3I CTNAG 1 cut(s) 110
LmnI GCTCC 2 cut(s) 72, 120
LpnPI CCDG 2 cut(s) 103, 166
MboII GAAGA 2 cut(s) 29, 45
MnlI CCTC 3 cut(s) 23, 37, 105
MseI TTAA 2 cut(s) 176, 199
MspI CCGG 1 cut(s) 90
NlaIV GGNNCC 1 cut(s) 116
PflFI GACNNNGTC 1 cut(s) 50
PspN4I GGNNCC 1 cut(s) 116
PsyI GACNNNGTC 1 cut(s) 50
SaqAI TTAA 2 cut(s) 176, 199
SetI ASST 4 cut(s) 77, 107, 128, 189
SfcI CTRYAG 1 cut(s) 170
SgeI CNNG 9 cut(s) 53, 67, 88, 102, 118, 146, 160, 172, 193
TaaI ACNGT 2 cut(s) 85, 174
Tru1I TTAA 2 cut(s) 176, 199
Tru9I TTAA 2 cut(s) 176, 199
TspDTI ATGAA 2 cut(s) 17, 128
Tth111I GACNNNGTC 1 cut(s) 50
XagI CCTNNNNNAGG 1 cut(s) 109
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.