RchiOBHm_Chr4g0420191

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Forward (+)
45843728 .. 45844130
403 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ38996

Sequence Viewer

Length: 261 bp
ATGTCCTCTAGAGCGTTGGGGTTCTTGCGCGAAAGGCAAAGAATCAGTATTCTTGGAAAGGATTTGGGGCAATCTCTAATGCTATACAGGAGCTTAAGCTATAAAAAAAATTGTTTGGGAAATGTGGAACTGATTTTGGTTTTGGTTTTGGTTTCTTCTCTTGGCCAAGGAAAAGATCGTCATCAGTTTCCTTTGAAATTCAAAATCAGGGTTTTGAAATTCAAAATCTTGATTTTGATCTTTGAAAACCCTAAATTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.96

Weight (kDa)

10.59

Isoelectric Point (pI)

37.29

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 30
AcoI YGGCCR 1 cut(s) 163
AcsI RAATTY 3 cut(s) 197, 218, 254
AflII CTTAAG 1 cut(s) 94
AgsI TTSAA 5 cut(s) 196, 202, 217, 223, 245
AluBI AGCT 2 cut(s) 93, 99
AluI AGCT 2 cut(s) 93, 99
AoxI GGCC 1 cut(s) 163
ApoI RAATTY 3 cut(s) 197, 218, 254
AspLEI GCGC 1 cut(s) 30
BalI TGGCCA 1 cut(s) 165
BfaI CTAG 1 cut(s) 9
BfrI CTTAAG 1 cut(s) 94
BsaBI GATNNNNATC 2 cut(s) 180, 236
BsaJI CCNNGG 1 cut(s) 166
Bse8I GATNNNNATC 2 cut(s) 180, 236
BseDI CCNNGG 1 cut(s) 166
BseJI GATNNNNATC 2 cut(s) 180, 236
Bsh1236I CGCG 1 cut(s) 30
BshFI GGCC 1 cut(s) 165
BsnI GGCC 1 cut(s) 165
Bsp143I GATC 2 cut(s) 175, 237
BspANI GGCC 1 cut(s) 165
BspFNI CGCG 1 cut(s) 30
BspTI CTTAAG 1 cut(s) 94
BssECI CCNNGG 1 cut(s) 166
BssMI GATC 2 cut(s) 175, 237
BssT1I CCWWGG 1 cut(s) 166
BstAFI CTTAAG 1 cut(s) 94
BstFNI CGCG 1 cut(s) 30
BstHHI GCGC 1 cut(s) 30
BstKTI GATC 2 cut(s) 178, 240
BstMBI GATC 2 cut(s) 175, 237
BstMWI GCNNNNNNNGC 1 cut(s) 34
BstUI CGCG 1 cut(s) 30
BsuRI GGCC 1 cut(s) 165
CfoI GCGC 1 cut(s) 30
CviJI RGCY 3 cut(s) 93, 99, 165
CviKI_1 RGCY 3 cut(s) 93, 99, 165
DpnI GATC 2 cut(s) 177, 239
DpnII GATC 2 cut(s) 175, 237
EaeI YGGCCR 1 cut(s) 163
Eco130I CCWWGG 1 cut(s) 166
EcoT14I CCWWGG 1 cut(s) 166
ErhI CCWWGG 1 cut(s) 166
FaiI YATR 2 cut(s) 85, 102
FspBI CTAG 1 cut(s) 9
GlaI GCGC 1 cut(s) 29
HaeIII GGCC 1 cut(s) 165
HhaI GCGC 1 cut(s) 30
Hin6I GCGC 1 cut(s) 28
HinP1I GCGC 1 cut(s) 28
HinfI GANTC 1 cut(s) 42
Hpy188III TCNNGA 2 cut(s) 9, 229
HpyF10VI GCNNNNNNNGC 1 cut(s) 34
HspAI GCGC 1 cut(s) 28
Kzo9I GATC 2 cut(s) 175, 237
LmnI GCTCC 1 cut(s) 90
LpnPI CCDG 2 cut(s) 73, 193
MaeI CTAG 1 cut(s) 9
MalI GATC 2 cut(s) 177, 239
MboI GATC 2 cut(s) 175, 237
MboII GAAGA 1 cut(s) 147
MlsI TGGCCA 1 cut(s) 165
MluCI AATT 4 cut(s) 109, 197, 218, 254
MluNI TGGCCA 1 cut(s) 165
MnlI CCTC 1 cut(s) 16
Mox20I TGGCCA 1 cut(s) 165
MscI TGGCCA 1 cut(s) 165
MseI TTAA 2 cut(s) 95, 259
Msp20I TGGCCA 1 cut(s) 165
MspCI CTTAAG 1 cut(s) 94
MvnI CGCG 1 cut(s) 30
MwoI GCNNNNNNNGC 1 cut(s) 34
NdeII GATC 2 cut(s) 175, 237
PfeI GAWTC 1 cut(s) 42
SaqAI TTAA 2 cut(s) 95, 259
Sau3AI GATC 2 cut(s) 175, 237
SetI ASST 2 cut(s) 95, 101
SgeI CNNG 9 cut(s) 21, 37, 41, 65, 100, 173, 179, 220, 241
SmlI CTYRAG 1 cut(s) 94
SmoI CTYRAG 1 cut(s) 94
Sse9I AATT 4 cut(s) 109, 197, 218, 254
SspMI CTAG 1 cut(s) 9
StyI CCWWGG 1 cut(s) 166
TasI AATT 4 cut(s) 109, 197, 218, 254
TfiI GAWTC 1 cut(s) 42
Tru1I TTAA 2 cut(s) 95, 259
Tru9I TTAA 2 cut(s) 95, 259
Vha464I CTTAAG 1 cut(s) 94
XapI RAATTY 3 cut(s) 197, 218, 254
XbaI TCTAGA 1 cut(s) 8
XspI CTAG 1 cut(s) 9
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.