RchiOBHm_Chr2g0157291

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
Physical Location & Seq
Forward (+)
73717479 .. 73717932
454 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ52602

Sequence Viewer

Length: 168 bp
ATGAAAAAGTTGGACAGTTATAGTACTGATGTTGACCGTATGAAAAAGTTGATGTTGGTCAACCTGAGTATAGCCCTCTTGAGTTCTCTCTGTCCCTGTGCTACACGAAGTTACTCCAGTATTATGTGGATCATCCTGAAGAAAGAAGAAATCAACAAGGCTTCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

55

Amino Acids

6.27

Weight (kDa)

9.34

Isoelectric Point (pI)

38.95

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 137
AcuI CTGAAG 1 cut(s) 158
AfaI GTAC 1 cut(s) 25
AlwI GGATC 1 cut(s) 137
BmcAI AGTACT 1 cut(s) 25
BpmI CTGGAG 1 cut(s) 100
BpuEI CTTGAG 1 cut(s) 100
Bse1I ACTGG 1 cut(s) 117
BseGI GGATG 1 cut(s) 132
BseMII CTCAG 1 cut(s) 56
BseNI ACTGG 1 cut(s) 117
BslFI GGGAC 1 cut(s) 78
BsmFI GGGAC 1 cut(s) 78
Bsp143I GATC 1 cut(s) 129
BspCNI CTCAG 1 cut(s) 57
BspPI GGATC 1 cut(s) 137
BsrI ACTGG 1 cut(s) 117
BssMI GATC 1 cut(s) 129
Bst4CI ACNGT 2 cut(s) 17, 38
BstDEI CTNAG 1 cut(s) 65
BstF5I GGATG 1 cut(s) 132
BstKTI GATC 1 cut(s) 132
BstMBI GATC 1 cut(s) 129
BtsCI GGATG 1 cut(s) 132
Csp6I GTAC 1 cut(s) 24
CviJI RGCY 2 cut(s) 74, 161
CviKI_1 RGCY 2 cut(s) 74, 161
CviQI GTAC 1 cut(s) 24
DdeI CTNAG 1 cut(s) 65
DpnI GATC 1 cut(s) 131
DpnII GATC 1 cut(s) 129
Eco57I CTGAAG 1 cut(s) 158
FaiI YATR 4 cut(s) 21, 41, 71, 125
FaqI GGGAC 1 cut(s) 78
FokI GGATG 1 cut(s) 119
GsuI CTGGAG 1 cut(s) 100
HincII GTYRAC 2 cut(s) 34, 61
HindII GTYRAC 2 cut(s) 34, 61
Hpy166II GTNNAC 2 cut(s) 34, 61
Hpy188III TCNNGA 2 cut(s) 79, 136
Hpy8I GTNNAC 2 cut(s) 34, 61
HpyCH4III ACNGT 2 cut(s) 17, 38
HpyF3I CTNAG 1 cut(s) 65
Kzo9I GATC 1 cut(s) 129
LpnPI CCDG 4 cut(s) 77, 109, 130, 149
MaeIII GTNAC 1 cut(s) 110
MalI GATC 1 cut(s) 131
MboI GATC 1 cut(s) 129
MboII GAAGA 2 cut(s) 151, 158
MnlI CCTC 1 cut(s) 86
NdeII GATC 1 cut(s) 129
RsaI GTAC 1 cut(s) 25
RsaNI GTAC 1 cut(s) 24
Sau3AI GATC 1 cut(s) 129
ScaI AGTACT 1 cut(s) 25
SetI ASST 1 cut(s) 66
SgeI CNNG 6 cut(s) 76, 91, 108, 117, 129, 148
SmlI CTYRAG 1 cut(s) 79
SmoI CTYRAG 1 cut(s) 79
TaaI ACNGT 2 cut(s) 17, 38
TatI WGTACW 1 cut(s) 23
TspDTI ATGAA 2 cut(s) 17, 56
ZrmI AGTACT 1 cut(s) 25
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.