RchiOBHm_Chr5g0043701

Lactation elevated protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
38770994 .. 38772175
1182 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32195

Sequence Viewer

Length: 165 bp
ATGATCAACCATGTATGTTGCAGGCCAAATAGGGAGGTTGAGTATAAGAGCTTAGTTGAGCAGGGGAAGCTGCAACATGATCCGAATCAAGTAGCCGTGGCTTCTCAATTGGAATACTTGCACGGGAGATTAGAGCATTATGAGAAATGGAGGAATATCATATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

54

Amino Acids

6.47

Weight (kDa)

6.89

Isoelectric Point (pI)

34.46

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 74
AluBI AGCT 2 cut(s) 51, 70
AluI AGCT 2 cut(s) 51, 70
AlwI GGATC 1 cut(s) 74
AoxI GGCC 1 cut(s) 23
ApeKI GCWGC 1 cut(s) 70
BbvI GCAGC 1 cut(s) 57
BceAI ACGGC 1 cut(s) 80
BclI TGATCA 1 cut(s) 3
BisI GCNGC 1 cut(s) 71
BlsI GCNGC 1 cut(s) 72
BsaBI GATNNNNATC 1 cut(s) 84
BsaJI CCNNGG 1 cut(s) 96
BsaXI ACNNNNNCTCC 2 cut(s) 26, 56
Bse8I GATNNNNATC 1 cut(s) 84
BseDI CCNNGG 1 cut(s) 96
BseJI GATNNNNATC 1 cut(s) 84
BseXI GCAGC 1 cut(s) 57
BshFI GGCC 1 cut(s) 25
BsnI GGCC 1 cut(s) 25
Bsp143I GATC 2 cut(s) 3, 79
BspANI GGCC 1 cut(s) 25
BspPI GGATC 1 cut(s) 74
BssECI CCNNGG 1 cut(s) 96
BssMI GATC 2 cut(s) 3, 79
BstC8I GCNNGC 1 cut(s) 23
BstDEI CTNAG 1 cut(s) 52
BstDSI CCRYGG 1 cut(s) 96
BstKTI GATC 2 cut(s) 6, 82
BstMBI GATC 2 cut(s) 3, 79
BstMWI GCNNNNNNNGC 1 cut(s) 67
BstV1I GCAGC 1 cut(s) 57
BsuRI GGCC 1 cut(s) 25
BtgI CCRYGG 1 cut(s) 96
Cac8I GCNNGC 1 cut(s) 23
CviAII CATG 2 cut(s) 11, 77
CviJI RGCY 5 cut(s) 25, 51, 70, 95, 101
CviKI_1 RGCY 5 cut(s) 25, 51, 70, 95, 101
DdeI CTNAG 1 cut(s) 52
DpnI GATC 2 cut(s) 5, 81
DpnII GATC 2 cut(s) 3, 79
FaeI CATG 2 cut(s) 14, 80
FaiI YATR 7 cut(s) 12, 16, 45, 78, 141, 161, 163
FatI CATG 2 cut(s) 10, 76
FbaI TGATCA 1 cut(s) 3
Fnu4HI GCNGC 1 cut(s) 71
Fsp4HI GCNGC 1 cut(s) 71
GluI GCNGC 1 cut(s) 71
HaeIII GGCC 1 cut(s) 25
Hin1II CATG 2 cut(s) 14, 80
HinfI GANTC 1 cut(s) 85
Hpy188I TCNGA 1 cut(s) 84
HpyCH4V TGCA 3 cut(s) 21, 73, 121
HpyF10VI GCNNNNNNNGC 1 cut(s) 67
HpyF3I CTNAG 1 cut(s) 52
Hsp92II CATG 2 cut(s) 14, 80
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 2 cut(s) 3, 79
LpnPI CCDG 2 cut(s) 7, 47
Lsp1109I GCAGC 1 cut(s) 57
MalI GATC 2 cut(s) 5, 81
MboI GATC 2 cut(s) 3, 79
MfeI CAATTG 1 cut(s) 107
MluCI AATT 1 cut(s) 107
MnlI CCTC 2 cut(s) 28, 144
MunI CAATTG 1 cut(s) 107
MwoI GCNNNNNNNGC 1 cut(s) 67
NdeII GATC 2 cut(s) 3, 79
NlaIII CATG 2 cut(s) 14, 80
PfeI GAWTC 1 cut(s) 85
PkrI GCNGC 1 cut(s) 72
SatI GCNGC 1 cut(s) 71
Sau3AI GATC 2 cut(s) 3, 79
SetI ASST 3 cut(s) 39, 53, 72
SgeI CNNG 9 cut(s) 23, 34, 74, 89, 101, 109, 130, 134, 136
Sse9I AATT 1 cut(s) 107
TasI AATT 1 cut(s) 107
TfiI GAWTC 1 cut(s) 85
TseI GCWGC 1 cut(s) 70
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.