RchiOBHm_Chr5g0072341

Lactation elevated protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
78265750 .. 78269331
3582 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34731

Sequence Viewer

Length: 240 bp
ATGGTGTATAAGAGCTTAGTTGAGCAAGGGAAGCTGCAACATGATCCGAATCAAGAAGTCATGGATTCTCAATTGGAATACTTGCTCCGAGGCAAGTCATCCCAATTGAGAATGCGATGGAGGATTTTAATGGAGGAAGCTGAGAATAAGCAGAAGGATGACATGTGGACATCAGTGAACAACCAAAGGAATAAGCTTTTCCAGAGATGGATATGCAAGTATGCTATTGATTTGTTTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

79

Amino Acids

9.68

Weight (kDa)

8.82

Isoelectric Point (pI)

57.02

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 38
AflIII ACRYGT 1 cut(s) 162
AluBI AGCT 4 cut(s) 15, 34, 140, 196
AluI AGCT 4 cut(s) 15, 34, 140, 196
AlwI GGATC 1 cut(s) 38
ApeKI GCWGC 1 cut(s) 34
BbvI GCAGC 1 cut(s) 21
BccI CCATC 2 cut(s) 111, 201
BisI GCNGC 1 cut(s) 35
BlsI GCNGC 1 cut(s) 36
BsaBI GATNNNNATC 1 cut(s) 48
BsaJI CCNNGG 1 cut(s) 88
Bse8I GATNNNNATC 1 cut(s) 48
BseDI CCNNGG 1 cut(s) 88
BseGI GGATG 2 cut(s) 98, 163
BseJI GATNNNNATC 1 cut(s) 48
BseMII CTCAG 1 cut(s) 132
BseXI GCAGC 1 cut(s) 21
BsmI GAATGC 1 cut(s) 117
Bsp143I GATC 1 cut(s) 43
BspCNI CTCAG 1 cut(s) 133
BspPI GGATC 1 cut(s) 38
BssECI CCNNGG 1 cut(s) 88
BssMI GATC 1 cut(s) 43
BstDEI CTNAG 2 cut(s) 16, 141
BstF5I GGATG 2 cut(s) 98, 163
BstKTI GATC 1 cut(s) 46
BstMBI GATC 1 cut(s) 43
BstMWI GCNNNNNNNGC 1 cut(s) 31
BstNSI RCATGY 1 cut(s) 166
BstV1I GCAGC 1 cut(s) 21
BtgZI GCGATG 1 cut(s) 130
BtsCI GGATG 2 cut(s) 98, 163
BtsIMutI CAGTG 1 cut(s) 180
CviAII CATG 3 cut(s) 41, 61, 163
CviJI RGCY 4 cut(s) 15, 34, 140, 196
CviKI_1 RGCY 4 cut(s) 15, 34, 140, 196
DdeI CTNAG 2 cut(s) 16, 141
DpnI GATC 1 cut(s) 45
DpnII GATC 1 cut(s) 43
FaeI CATG 3 cut(s) 44, 64, 166
FaiI YATR 6 cut(s) 9, 42, 62, 164, 214, 222
FatI CATG 3 cut(s) 40, 60, 162
Fnu4HI GCNGC 1 cut(s) 35
FokI GGATG 2 cut(s) 85, 170
Fsp4HI GCNGC 1 cut(s) 35
GluI GCNGC 1 cut(s) 35
Hin1II CATG 3 cut(s) 44, 64, 166
HindIII AAGCTT 1 cut(s) 194
HinfI GANTC 2 cut(s) 49, 65
Hpy166II GTNNAC 2 cut(s) 168, 178
Hpy188I TCNGA 2 cut(s) 48, 89
Hpy188III TCNNGA 2 cut(s) 53, 202
Hpy8I GTNNAC 2 cut(s) 168, 178
HpyAV CCTTC 1 cut(s) 148
HpyCH4V TGCA 2 cut(s) 37, 216
HpyF10VI GCNNNNNNNGC 1 cut(s) 31
HpyF3I CTNAG 2 cut(s) 16, 141
Hsp92II CATG 3 cut(s) 44, 64, 166
Kzo9I GATC 1 cut(s) 43
LmnI GCTCC 1 cut(s) 90
LpnPI CCDG 1 cut(s) 215
Lsp1109I GCAGC 1 cut(s) 21
MalI GATC 1 cut(s) 45
MboI GATC 1 cut(s) 43
MfeI CAATTG 2 cut(s) 71, 104
MluCI AATT 2 cut(s) 71, 104
MnlI CCTC 3 cut(s) 83, 114, 127
MseI TTAA 2 cut(s) 128, 238
MunI CAATTG 2 cut(s) 71, 104
Mva1269I GAATGC 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 31
NdeII GATC 1 cut(s) 43
NlaIII CATG 3 cut(s) 44, 64, 166
NspI RCATGY 1 cut(s) 166
PciI ACATGT 1 cut(s) 162
PctI GAATGC 1 cut(s) 117
PfeI GAWTC 2 cut(s) 49, 65
PkrI GCNGC 1 cut(s) 36
PscI ACATGT 1 cut(s) 162
SaqAI TTAA 2 cut(s) 128, 238
SatI GCNGC 1 cut(s) 35
Sau3AI GATC 1 cut(s) 43
SetI ASST 4 cut(s) 17, 36, 142, 198
Sse9I AATT 2 cut(s) 71, 104
TasI AATT 2 cut(s) 71, 104
TfiI GAWTC 2 cut(s) 49, 65
Tru1I TTAA 2 cut(s) 128, 238
Tru9I TTAA 2 cut(s) 128, 238
TscAI CASTG 1 cut(s) 180
TseI GCWGC 1 cut(s) 34
TspRI CASTG 1 cut(s) 180
XceI RCATGY 1 cut(s) 166
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.