RchiOBHm_Chr5g0034521

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Forward (+)
28385116 .. 28385482
367 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ31350

Sequence Viewer

Length: 216 bp
ATGTCCTTCTCCCCCAAATCGATTCAGCCTTATCTGAGGTCTGGAAGCGGTCGTAGGCAACAACAATTTGATATCTCCCCCAATTTCGAAGCGGTGTCTCCGCCCATTGCTGCCTCTCTCTGCCTCCCCCTCTCTCTCATATCCCAGCTCCACTTCTCTGCCTCCCTCTCTCTCATCTCCAAATTGTTTTGGTTTAATGGAGGACAGAGGAACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

71

Amino Acids

7.86

Weight (kDa)

10.28

Isoelectric Point (pI)

70.55

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 48, 92, 101
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
Alw26I GTCTC 1 cut(s) 102
ApeKI GCWGC 1 cut(s) 110
AsuII TTCGAA 1 cut(s) 87
BbvI GCAGC 1 cut(s) 97
BcoDI GTCTC 1 cut(s) 102
BfaI CTAG 1 cut(s) 214
BisI GCNGC 1 cut(s) 111
BlsI GCNGC 1 cut(s) 112
Bpu14I TTCGAA 1 cut(s) 87
Bsa29I ATCGAT 1 cut(s) 20
Bse3DI GCAATG 1 cut(s) 105
BseCI ATCGAT 1 cut(s) 20
BseMI GCAATG 1 cut(s) 105
BseMII CTCAG 1 cut(s) 26
BseXI GCAGC 1 cut(s) 97
BseYI CCCAGC 1 cut(s) 144
Bsh1285I CGRYCG 1 cut(s) 52
BshVI ATCGAT 1 cut(s) 20
BsiEI CGRYCG 1 cut(s) 52
BsmAI GTCTC 1 cut(s) 102
Bsp119I TTCGAA 1 cut(s) 87
BspACI CCGC 3 cut(s) 48, 92, 101
BspCNI CTCAG 1 cut(s) 27
BspDI ATCGAT 1 cut(s) 20
BspT104I TTCGAA 1 cut(s) 87
BsrDI GCAATG 1 cut(s) 105
BstBI TTCGAA 1 cut(s) 87
BstDEI CTNAG 1 cut(s) 35
BstMAI GTCTC 1 cut(s) 102
BstMCI CGRYCG 1 cut(s) 52
BstV1I GCAGC 1 cut(s) 97
Bsu15I ATCGAT 1 cut(s) 20
BsuTUI ATCGAT 1 cut(s) 20
ClaI ATCGAT 1 cut(s) 20
CviJI RGCY 2 cut(s) 28, 148
CviKI_1 RGCY 2 cut(s) 28, 148
DdeI CTNAG 1 cut(s) 35
EciI GGCGGA 1 cut(s) 90
Eco32I GATATC 1 cut(s) 73
EcoRV GATATC 1 cut(s) 73
FaiI YATR 1 cut(s) 140
Fnu4HI GCNGC 1 cut(s) 111
Fsp4HI GCNGC 1 cut(s) 111
FspBI CTAG 1 cut(s) 214
GluI GCNGC 1 cut(s) 111
GsaI CCCAGC 1 cut(s) 148
HinfI GANTC 1 cut(s) 22
Hpy188I TCNGA 1 cut(s) 36
Hpy188III TCNNGA 1 cut(s) 42
HpyAV CCTTC 1 cut(s) 16
HpyF3I CTNAG 1 cut(s) 35
LmnI GCTCC 1 cut(s) 153
LpnPI CCDG 2 cut(s) 27, 158
Lsp1109I GCAGC 1 cut(s) 97
MaeI CTAG 1 cut(s) 214
MluCI AATT 3 cut(s) 65, 82, 182
MnlI CCTC 8 cut(s) 30, 124, 134, 140, 172, 176, 194, 201
MseI TTAA 1 cut(s) 195
NspV TTCGAA 1 cut(s) 87
PfeI GAWTC 1 cut(s) 22
PkrI GCNGC 1 cut(s) 112
PspFI CCCAGC 1 cut(s) 144
SaqAI TTAA 1 cut(s) 195
SatI GCNGC 1 cut(s) 111
SetI ASST 2 cut(s) 41, 150
SfuI TTCGAA 1 cut(s) 87
SgeI CNNG 2 cut(s) 54, 157
Sse9I AATT 3 cut(s) 65, 82, 182
SsiI CCGC 3 cut(s) 48, 92, 101
SspMI CTAG 1 cut(s) 214
TaqI TCGA 2 cut(s) 20, 87
TasI AATT 3 cut(s) 65, 82, 182
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 1 cut(s) 195
Tru9I TTAA 1 cut(s) 195
TseI GCWGC 1 cut(s) 110
XspI CTAG 1 cut(s) 214
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.