Rroxscaffold_2G00127590

No description available

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000002
Physical Location & Seq
Reverse (-)
63192872 .. 63193825
954 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_2G00127590.1

Sequence Viewer

Length: 255 bp
ATGTCCTTCTCCCCCAAATCGATTCAGCCTTATCCGAGGTCAGGGAATTTCGACAAGGCATGGAGAAATTTGTTTAAATTGCGCGGTGGCCGGAGCTTGGCAGTAGGATTGAACCTCCTGACTGGCAGCAGATATATTGGGAAACGCATCTGCAAAACACCTATTGAGGAACAGCAAATAGCAGAGCTTGGAACTAAGGTGGATAAGTTCCAAGGAGCATGTAAGCTCATTTCTTTCTCTTTGAATGTTCAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

84

Amino Acids

9.4

Weight (kDa)

10.18

Isoelectric Point (pI)

47.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 84
AciI CCGC 1 cut(s) 84
AcoI YGGCCR 1 cut(s) 88
AcsI RAATTY 2 cut(s) 46, 67
AfiI CCNNNNNNNGG 2 cut(s) 41, 97
AgsI TTSAA 3 cut(s) 112, 244, 251
AluBI AGCT 3 cut(s) 96, 187, 226
AluI AGCT 3 cut(s) 96, 187, 226
AoxI GGCC 1 cut(s) 88
ApeKI GCWGC 1 cut(s) 126
ApoI RAATTY 2 cut(s) 46, 67
AspLEI GCGC 1 cut(s) 84
BbvI GCAGC 1 cut(s) 138
BisI GCNGC 1 cut(s) 127
BlsI GCNGC 1 cut(s) 128
BmsI GCATC 1 cut(s) 156
Bsa29I ATCGAT 1 cut(s) 20
BsaJI CCNNGG 2 cut(s) 35, 211
Bsc4I CCNNNNNNNGG 2 cut(s) 41, 97
Bse1I ACTGG 1 cut(s) 127
BseCI ATCGAT 1 cut(s) 20
BseDI CCNNGG 2 cut(s) 35, 211
BseLI CCNNNNNNNGG 2 cut(s) 41, 97
BseNI ACTGG 1 cut(s) 127
BseXI GCAGC 1 cut(s) 138
Bsh1236I CGCG 1 cut(s) 84
BshFI GGCC 1 cut(s) 90
BshVI ATCGAT 1 cut(s) 20
BsiSI CCGG 1 cut(s) 91
BslI CCNNNNNNNGG 2 cut(s) 41, 97
BsnI GGCC 1 cut(s) 90
BspACI CCGC 1 cut(s) 84
BspANI GGCC 1 cut(s) 90
BspDI ATCGAT 1 cut(s) 20
BspFNI CGCG 1 cut(s) 84
BsrI ACTGG 1 cut(s) 127
BssECI CCNNGG 2 cut(s) 35, 211
BssT1I CCWWGG 1 cut(s) 211
BstDEI CTNAG 1 cut(s) 195
BstFNI CGCG 1 cut(s) 84
BstHHI GCGC 1 cut(s) 84
BstNSI RCATGY 1 cut(s) 222
BstUI CGCG 1 cut(s) 84
BstV1I GCAGC 1 cut(s) 138
Bsu15I ATCGAT 1 cut(s) 20
BsuRI GGCC 1 cut(s) 90
BsuTUI ATCGAT 1 cut(s) 20
CfoI GCGC 1 cut(s) 84
ClaI ATCGAT 1 cut(s) 20
CviAII CATG 2 cut(s) 60, 219
CviJI RGCY 5 cut(s) 28, 90, 96, 187, 226
CviKI_1 RGCY 5 cut(s) 28, 90, 96, 187, 226
DdeI CTNAG 1 cut(s) 195
DraI TTTAAA 1 cut(s) 76
EaeI YGGCCR 1 cut(s) 88
Eco130I CCWWGG 1 cut(s) 211
EcoT14I CCWWGG 1 cut(s) 211
ErhI CCWWGG 1 cut(s) 211
FaeI CATG 2 cut(s) 63, 222
FaiI YATR 3 cut(s) 61, 135, 220
FatI CATG 2 cut(s) 59, 218
Fnu4HI GCNGC 1 cut(s) 127
Fsp4HI GCNGC 1 cut(s) 127
GlaI GCGC 1 cut(s) 83
GluI GCNGC 1 cut(s) 127
HaeIII GGCC 1 cut(s) 90
HapII CCGG 1 cut(s) 91
HhaI GCGC 1 cut(s) 84
Hin1II CATG 2 cut(s) 63, 222
Hin6I GCGC 1 cut(s) 82
HinP1I GCGC 1 cut(s) 82
HinfI GANTC 1 cut(s) 22
HpaII CCGG 1 cut(s) 91
Hpy188I TCNGA 1 cut(s) 36
Hpy188III TCNNGA 1 cut(s) 118
HpyAV CCTTC 1 cut(s) 16
HpyCH4V TGCA 1 cut(s) 153
HpyF3I CTNAG 1 cut(s) 195
Hsp92II CATG 2 cut(s) 63, 222
HspAI GCGC 1 cut(s) 82
LmnI GCTCC 2 cut(s) 93, 215
LpnPI CCDG 4 cut(s) 27, 104, 108, 131
Lsp1109I GCAGC 1 cut(s) 138
LweI GCATC 1 cut(s) 156
MluCI AATT 3 cut(s) 46, 67, 77
MnlI CCTC 3 cut(s) 30, 125, 160
MseI TTAA 1 cut(s) 75
MspI CCGG 1 cut(s) 91
MvnI CGCG 1 cut(s) 84
NlaIII CATG 2 cut(s) 63, 222
NspI RCATGY 1 cut(s) 222
PfeI GAWTC 1 cut(s) 22
PkrI GCNGC 1 cut(s) 128
SaqAI TTAA 1 cut(s) 75
SatI GCNGC 1 cut(s) 127
SetI ASST 7 cut(s) 41, 98, 117, 163, 189, 201, 228
SfaNI GCATC 1 cut(s) 156
Sse9I AATT 3 cut(s) 46, 67, 77
SsiI CCGC 1 cut(s) 84
StyI CCWWGG 1 cut(s) 211
TaqI TCGA 2 cut(s) 20, 51
TasI AATT 3 cut(s) 46, 67, 77
TfiI GAWTC 1 cut(s) 22
Tru1I TTAA 1 cut(s) 75
Tru9I TTAA 1 cut(s) 75
TseI GCWGC 1 cut(s) 126
XapI RAATTY 2 cut(s) 46, 67
XceI RCATGY 1 cut(s) 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.