Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0000404.1

Orthogroup ID

OG0008897

Physical Location & Seq

Genomic Coordinates Forward (+)

18825 .. 19175

Gene Structure 351 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0000404.1_g000005.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 351 bp

atgtcgtctatggagatcgacaatcccaagctgatgtcgtctatggagatcgataatcccaagccaaacacctccaatcagtttggtcgttctccgatccattcccagaagacgaagatgaagatgatgatgccagaagagtatgatccagccaagccgaacgactacgcgcagtacaggagggagagaaagaagaaggcgatggagggtgaggtgagaagagagctcgatcagagaagacaggaggaggagaggacaaagaggcaggagagagagagagagagagaaaccatcggatctgagagaggaggatcagaggaagagaagaataagatttttatttttttttaa

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005634 GO:0005737 GO:0008150 GO:0009507 GO:0009536 GO:0010468 GO:0019219 GO:0019222 GO:0031323 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043484 GO:0044424 GO:0044444 GO:0044464 GO:0050789 GO:0050794 GO:0051171 GO:0051252 GO:0060255 GO:0065007 GO:0080090

KEGG Pathways

Metabolic & Signaling

ko03040 map03040

Pfam Domains

Protein Families

G-patch RRM_1

Protein Analysis

116

Amino Acids

13.99

Weight (kDa)

8.86

Isoelectric Point (pI)

86.55

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0008897)

Species	Orthologous Gene IDs
rosa_chinensis	RchiOBHm_Chr1g0315271 RchiOBHm_Chr2g0157291 RchiOBHm_Chr5g0034521 RchiOBHm_Chr5g0043701 RchiOBHm_Chr5g0072341
rosa_laevigata	RLG00000006199 RLG00000014447
rosa_multiflora	Rmu_sc0000404.1_g000005 Rmu_sc0000663.1_g000020 Rmu_sc0006798.1_g000001
rosa_roxburghii	Rroxscaffold_1G00044040 Rroxscaffold_2G00127590 Rroxscaffold_2G00128420 Rroxscaffold_5G00373610 Rroxscaffold_6G00425320
rosa_rugosa	Rorug07G0259600
rosa_samantha	Rh1AG066800 Rh1CG269600 Rh2CG273500 Rh5AG473900 Rh5BG015900 Rh5CG271900 Rh5DG308400

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccII	CGCG	1 cut(s)	170
AclWI	GGATC	4 cut(s)	91, 140, 304, 319
AfaI	GTAC	1 cut(s)	176
AluBI	AGCT	2 cut(s)	31, 226
AluI	AGCT	2 cut(s)	31, 226
Alw21I	GWGCWC	1 cut(s)	228
AlwI	GGATC	4 cut(s)	91, 140, 304, 319
AspLEI	GCGC	1 cut(s)	172
AsuHPI	GGTGA	2 cut(s)	221, 226
BanII	GRGCYC	1 cut(s)	228
BbsI	GAAGAC	2 cut(s)	116, 244
Bbv12I	GWGCWC	1 cut(s)	228
BccI	CCATC	2 cut(s)	196, 299
BmsI	GCATC	1 cut(s)	120
BpiI	GAAGAC	2 cut(s)	116, 244
Bsa29I	ATCGAT	1 cut(s)	51
BseCI	ATCGAT	1 cut(s)	51
BseMII	CTCAG	1 cut(s)	291
BseRI	GAGGAG	3 cut(s)	260, 263, 321
Bsh1236I	CGCG	1 cut(s)	170
BshVI	ATCGAT	1 cut(s)	51
BsiHKAI	GWGCWC	1 cut(s)	228
Bsp1286I	GDGCHC	1 cut(s)	228
Bsp143I	GATC	7 cut(s)	15, 48, 96, 145, 229, 296, 311
BspCNI	CTCAG	1 cut(s)	292
BspDI	ATCGAT	1 cut(s)	51
BspFNI	CGCG	1 cut(s)	170
BspPI	GGATC	4 cut(s)	91, 140, 304, 319
BssMI	GATC	7 cut(s)	15, 48, 96, 145, 229, 296, 311
Bst6I	CTCTTC	3 cut(s)	132, 214, 315
BstDEI	CTNAG	1 cut(s)	300
BstFNI	CGCG	1 cut(s)	170
BstHHI	GCGC	1 cut(s)	172
BstKTI	GATC	7 cut(s)	18, 51, 99, 148, 232, 299, 314
BstMBI	GATC	7 cut(s)	15, 48, 96, 145, 229, 296, 311
BstUI	CGCG	1 cut(s)	170
BstV2I	GAAGAC	2 cut(s)	116, 244
BstX2I	RGATCY	1 cut(s)	296
BstYI	RGATCY	1 cut(s)	296
Bsu15I	ATCGAT	1 cut(s)	51
BsuTUI	ATCGAT	1 cut(s)	51
BtgZI	GCGATG	1 cut(s)	215
CfoI	GCGC	1 cut(s)	172
ClaI	ATCGAT	1 cut(s)	51
Csp6I	GTAC	1 cut(s)	175
CviJI	RGCY	5 cut(s)	31, 64, 152, 157, 226
CviKI_1	RGCY	5 cut(s)	31, 64, 152, 157, 226
CviQI	GTAC	1 cut(s)	175
DdeI	CTNAG	1 cut(s)	300
DpnI	GATC	7 cut(s)	17, 50, 98, 147, 231, 298, 313
DpnII	GATC	7 cut(s)	15, 48, 96, 145, 229, 296, 311
Eam1104I	CTCTTC	3 cut(s)	132, 214, 315
EarI	CTCTTC	3 cut(s)	132, 214, 315
Ecl136II	GAGCTC	1 cut(s)	226
Eco24I	GRGCYC	1 cut(s)	228
Eco53kI	GAGCTC	1 cut(s)	226
EcoICRI	GAGCTC	1 cut(s)	226
EcoT38I	GRGCYC	1 cut(s)	228
FaiI	YATR	3 cut(s)	11, 44, 144
FriOI	GRGCYC	1 cut(s)	228
GlaI	GCGC	1 cut(s)	171
HhaI	GCGC	1 cut(s)	172
Hin6I	GCGC	1 cut(s)	170
HinP1I	GCGC	1 cut(s)	170
HphI	GGTGA	2 cut(s)	221, 226
Hpy188I	TCNGA	5 cut(s)	96, 234, 296, 301, 316
HpyAV	CCTTC	1 cut(s)	190
HpyF3I	CTNAG	1 cut(s)	300
HspAI	GCGC	1 cut(s)	170
Kzo9I	GATC	7 cut(s)	15, 48, 96, 145, 229, 296, 311
LpnPI	CCDG	6 cut(s)	119, 147, 162, 163, 227, 251
LweI	GCATC	1 cut(s)	120
MalI	GATC	7 cut(s)	17, 50, 98, 147, 231, 298, 313
MboI	GATC	7 cut(s)	15, 48, 96, 145, 229, 296, 311
MboII	GAAGA	9 cut(s)	121, 127, 133, 149, 205, 231, 249, 332, 337
MflI	RGATCY	1 cut(s)	296
MhlI	GDGCHC	1 cut(s)	228
MseI	TTAA	1 cut(s)	349
MvnI	CGCG	1 cut(s)	170
NdeII	GATC	7 cut(s)	15, 48, 96, 145, 229, 296, 311
Psp124BI	GAGCTC	1 cut(s)	228
PsuI	RGATCY	1 cut(s)	296
RsaI	GTAC	1 cut(s)	176
RsaNI	GTAC	1 cut(s)	175
SacI	GAGCTC	1 cut(s)	228
SaqAI	TTAA	1 cut(s)	349
Sau3AI	GATC	7 cut(s)	15, 48, 96, 145, 229, 296, 311
SduI	GDGCHC	1 cut(s)	228
SetI	ASST	4 cut(s)	33, 74, 216, 228
SfaNI	GCATC	1 cut(s)	120
SstI	GAGCTC	1 cut(s)	228
TaqI	TCGA	3 cut(s)	18, 51, 228
TatI	WGTACW	1 cut(s)	174
Tru1I	TTAA	1 cut(s)	349
Tru9I	TTAA	1 cut(s)	349
TspDTI	ATGAA	1 cut(s)	134

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.