Rmu_sc0006798.1_g000001

DNA-damage-repair toleration protein DRT111

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0006798.1
Physical Location & Seq
Forward (+)
233 .. 655
423 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0006798.1_g000001.1.cds

Sequence Viewer

Length: 423 bp
atgtcatggagatcgacaatcccgatgtcgtctatggagatcgacaatcccaagccgatgtcgtctatggagatcgataatcccaagtcaaacacctccaatcagtttggccattctccgatccattccttgggggagagaccaaaacggaaaaaggaaaccgaaaaatcccagaagacgaagatgaagatgccagaagagtacgatctagccaggtcgaacgattacgcagagtacaggagggagagaaagaagaaggcgatggaggctaaggtgaggagagagcttgatcggagaagacaggaggaagagaggacagagagggaggagagagagaatgagagagaaaccatcagagctgagagagagaggaggaggagaaaagaagaaaatatttttgaaatgacatttttagccatttaa

Protein Analysis

140

Amino Acids

17.12

Weight (kDa)

9.61

Isoelectric Point (pI)

95.44

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 130
AclWI GGATC 1 cut(s) 115
AcoI YGGCCR 1 cut(s) 109
AfaI GTAC 2 cut(s) 203, 236
AfiI CCNNNNNNNGG 1 cut(s) 130
AgsI TTSAA 1 cut(s) 401
AjnI CCWGG 1 cut(s) 212
AluBI AGCT 2 cut(s) 286, 359
AluI AGCT 2 cut(s) 286, 359
Alw26I GTCTC 1 cut(s) 133
AlwI GGATC 1 cut(s) 115
AoxI GGCC 1 cut(s) 109
AsuHPI GGTGA 1 cut(s) 286
BalI TGGCCA 1 cut(s) 111
BbsI GAAGAC 2 cut(s) 182, 304
BccI CCATC 2 cut(s) 256, 359
BciT130I CCWGG 1 cut(s) 214
BcoDI GTCTC 1 cut(s) 133
BfaI CTAG 1 cut(s) 209
Bme1390I CCNGG 1 cut(s) 214
BmrFI CCNGG 1 cut(s) 214
BmsI GCATC 1 cut(s) 180
BpiI GAAGAC 2 cut(s) 182, 304
Bpu10I CCTNAGC 1 cut(s) 270
Bsa29I ATCGAT 1 cut(s) 75
BsaI GGTCTC 1 cut(s) 133
BsaJI CCNNGG 1 cut(s) 129
Bsc4I CCNNNNNNNGG 1 cut(s) 130
BseBI CCWGG 1 cut(s) 214
BseCI ATCGAT 1 cut(s) 75
BseDI CCNNGG 1 cut(s) 129
BseLI CCNNNNNNNGG 1 cut(s) 130
BseMII CTCAG 1 cut(s) 351
BseRI GAGGAG 5 cut(s) 292, 341, 385, 388, 391
BshFI GGCC 1 cut(s) 111
BshVI ATCGAT 1 cut(s) 75
BslI CCNNNNNNNGG 1 cut(s) 130
BsmAI GTCTC 1 cut(s) 133
BsnI GGCC 1 cut(s) 111
Bso31I GGTCTC 1 cut(s) 133
Bsp143I GATC 6 cut(s) 11, 39, 72, 120, 205, 289
BspANI GGCC 1 cut(s) 111
BspCNI CTCAG 1 cut(s) 352
BspDI ATCGAT 1 cut(s) 75
BspPI GGATC 1 cut(s) 115
BspTNI GGTCTC 1 cut(s) 133
BssECI CCNNGG 1 cut(s) 129
BssMI GATC 6 cut(s) 11, 39, 72, 120, 205, 289
BssT1I CCWWGG 1 cut(s) 129
Bst2UI CCWGG 1 cut(s) 214
Bst6I CTCTTC 2 cut(s) 192, 303
BstDEI CTNAG 2 cut(s) 270, 360
BstKTI GATC 6 cut(s) 14, 42, 75, 123, 208, 292
BstMAI GTCTC 1 cut(s) 133
BstMBI GATC 6 cut(s) 11, 39, 72, 120, 205, 289
BstMWI GCNNNNNNNGC 1 cut(s) 266
BstNI CCWGG 1 cut(s) 214
BstSCI CCNGG 1 cut(s) 212
BstV2I GAAGAC 2 cut(s) 182, 304
Bsu15I ATCGAT 1 cut(s) 75
BsuRI GGCC 1 cut(s) 111
BsuTUI ATCGAT 1 cut(s) 75
BtgZI GCGATG 1 cut(s) 275
ClaI ATCGAT 1 cut(s) 75
Csp6I GTAC 2 cut(s) 202, 235
CviAII CATG 1 cut(s) 6
CviJI RGCY 7 cut(s) 55, 111, 212, 269, 286, 359, 416
CviKI_1 RGCY 7 cut(s) 55, 111, 212, 269, 286, 359, 416
CviQI GTAC 2 cut(s) 202, 235
DdeI CTNAG 2 cut(s) 270, 360
DpnI GATC 6 cut(s) 13, 41, 74, 122, 207, 291
DpnII GATC 6 cut(s) 11, 39, 72, 120, 205, 289
EaeI YGGCCR 1 cut(s) 109
Eam1104I CTCTTC 2 cut(s) 192, 303
EarI CTCTTC 2 cut(s) 192, 303
Eco130I CCWWGG 1 cut(s) 129
Eco31I GGTCTC 1 cut(s) 133
EcoRII CCWGG 1 cut(s) 212
EcoT14I CCWWGG 1 cut(s) 129
ErhI CCWWGG 1 cut(s) 129
FaeI CATG 1 cut(s) 9
FaiI YATR 3 cut(s) 7, 35, 68
FatI CATG 1 cut(s) 5
FspBI CTAG 1 cut(s) 209
HaeIII GGCC 1 cut(s) 111
Hin1II CATG 1 cut(s) 9
HphI GGTGA 1 cut(s) 286
Hpy188I TCNGA 3 cut(s) 120, 294, 356
Hpy188III TCNNGA 1 cut(s) 22
HpyAV CCTTC 1 cut(s) 250
HpyF10VI GCNNNNNNNGC 1 cut(s) 266
HpyF3I CTNAG 2 cut(s) 270, 360
Hsp92II CATG 1 cut(s) 9
Kzo9I GATC 6 cut(s) 11, 39, 72, 120, 205, 289
LpnPI CCDG 6 cut(s) 185, 199, 207, 223, 226, 287
LweI GCATC 1 cut(s) 180
MaeI CTAG 1 cut(s) 209
MalI GATC 6 cut(s) 13, 41, 74, 122, 207, 291
MboI GATC 6 cut(s) 11, 39, 72, 120, 205, 289
MboII GAAGA 8 cut(s) 187, 193, 199, 209, 265, 309, 320, 398
MlsI TGGCCA 1 cut(s) 111
MluNI TGGCCA 1 cut(s) 111
Mox20I TGGCCA 1 cut(s) 111
MscI TGGCCA 1 cut(s) 111
MseI TTAA 1 cut(s) 421
Msp20I TGGCCA 1 cut(s) 111
MspR9I CCNGG 1 cut(s) 214
MvaI CCWGG 1 cut(s) 214
MwoI GCNNNNNNNGC 1 cut(s) 266
NdeII GATC 6 cut(s) 11, 39, 72, 120, 205, 289
NlaIII CATG 1 cut(s) 9
PcsI WCGNNNNNNNCGW 1 cut(s) 20
PflMI CCANNNNNTGG 1 cut(s) 130
Psp6I CCWGG 1 cut(s) 212
PspGI CCWGG 1 cut(s) 212
RsaI GTAC 2 cut(s) 203, 236
RsaNI GTAC 2 cut(s) 202, 235
SaqAI TTAA 1 cut(s) 421
Sau3AI GATC 6 cut(s) 11, 39, 72, 120, 205, 289
ScrFI CCNGG 1 cut(s) 214
SetI ASST 5 cut(s) 98, 218, 276, 288, 361
SfaNI GCATC 1 cut(s) 180
SspI AATATT 1 cut(s) 394
SspMI CTAG 1 cut(s) 209
StyD4I CCNGG 1 cut(s) 212
StyI CCWWGG 1 cut(s) 129
TaqI TCGA 4 cut(s) 14, 42, 75, 218
TatI WGTACW 1 cut(s) 234
Tru1I TTAA 1 cut(s) 421
Tru9I TTAA 1 cut(s) 421
TspDTI ATGAA 1 cut(s) 200
TspGWI ACGGA 1 cut(s) 163
Van91I CCANNNNNTGG 1 cut(s) 130
XspI CTAG 1 cut(s) 209
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.