Rroxscaffold_5G00373610

ethylene-responsive transcription factor

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000005
Physical Location & Seq
Reverse (-)
54800056 .. 54802668
2613 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_5G00373610.1

Sequence Viewer

Length: 195 bp
ATGACCACTCTAACAAAAGAAGGATACTTGGCCTCTCTAAGAAGAAGAAGCACGGGCTTTTCAAGTCGTCTATCCAAATACAGAGGAGTTGCAAGTGTCATTACGCAGTATAAGAGCTTAGATAAGCAAGGGAAGCTGCAACATGATCCGAACCAAGGTTATTTATATGGAATTGATTTCACTGGCCATGAATGA

Protein Analysis

64

Amino Acids

7.26

Weight (kDa)

9.82

Isoelectric Point (pI)

31.35

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 140
AcoI YGGCCR 1 cut(s) 184
AfiI CCNNNNNNNGG 1 cut(s) 155
AgsI TTSAA 1 cut(s) 63
AluBI AGCT 2 cut(s) 117, 136
AluI AGCT 2 cut(s) 117, 136
AlwI GGATC 1 cut(s) 140
AoxI GGCC 2 cut(s) 30, 184
ApeKI GCWGC 1 cut(s) 136
BalI TGGCCA 1 cut(s) 186
BbvI GCAGC 1 cut(s) 123
BciVI GTATCC 1 cut(s) 17
BfuI GTATCC 1 cut(s) 17
BisI GCNGC 1 cut(s) 137
BlsI GCNGC 1 cut(s) 138
BsaJI CCNNGG 1 cut(s) 154
Bsc4I CCNNNNNNNGG 1 cut(s) 155
Bse1I ACTGG 1 cut(s) 187
BseDI CCNNGG 1 cut(s) 154
BseLI CCNNNNNNNGG 1 cut(s) 155
BseNI ACTGG 1 cut(s) 187
BseRI GAGGAG 1 cut(s) 99
BseXI GCAGC 1 cut(s) 123
BshFI GGCC 2 cut(s) 32, 186
BslI CCNNNNNNNGG 1 cut(s) 155
BsnI GGCC 2 cut(s) 32, 186
Bsp143I GATC 1 cut(s) 145
BspANI GGCC 2 cut(s) 32, 186
BspPI GGATC 1 cut(s) 140
BsrI ACTGG 1 cut(s) 187
BssECI CCNNGG 1 cut(s) 154
BssMI GATC 1 cut(s) 145
BssT1I CCWWGG 1 cut(s) 154
BstDEI CTNAG 2 cut(s) 38, 118
BstKTI GATC 1 cut(s) 148
BstMBI GATC 1 cut(s) 145
BstMWI GCNNNNNNNGC 1 cut(s) 133
BstV1I GCAGC 1 cut(s) 123
BsuI GTATCC 1 cut(s) 17
BsuRI GGCC 2 cut(s) 32, 186
BtsIMutI CAGTG 1 cut(s) 180
CviAII CATG 2 cut(s) 143, 188
CviJI RGCY 5 cut(s) 32, 57, 117, 136, 186
CviKI_1 RGCY 5 cut(s) 32, 57, 117, 136, 186
DdeI CTNAG 2 cut(s) 38, 118
DpnI GATC 1 cut(s) 147
DpnII GATC 1 cut(s) 145
EaeI YGGCCR 1 cut(s) 184
Eco130I CCWWGG 1 cut(s) 154
EcoT14I CCWWGG 1 cut(s) 154
ErhI CCWWGG 1 cut(s) 154
FaeI CATG 2 cut(s) 146, 191
FaiI YATR 5 cut(s) 111, 144, 166, 168, 189
FatI CATG 2 cut(s) 142, 187
Fnu4HI GCNGC 1 cut(s) 137
Fsp4HI GCNGC 1 cut(s) 137
GluI GCNGC 1 cut(s) 137
HaeIII GGCC 2 cut(s) 32, 186
Hin1II CATG 2 cut(s) 146, 191
Hpy188I TCNGA 1 cut(s) 150
HpyAV CCTTC 1 cut(s) 14
HpyCH4V TGCA 2 cut(s) 92, 139
HpyF10VI GCNNNNNNNGC 1 cut(s) 133
HpyF3I CTNAG 2 cut(s) 38, 118
Hsp92II CATG 2 cut(s) 146, 191
Kzo9I GATC 1 cut(s) 145
LpnPI CCDG 1 cut(s) 168
Lsp1109I GCAGC 1 cut(s) 123
MalI GATC 1 cut(s) 147
MboI GATC 1 cut(s) 145
MboII GAAGA 2 cut(s) 54, 57
MlsI TGGCCA 1 cut(s) 186
MluCI AATT 1 cut(s) 171
MluNI TGGCCA 1 cut(s) 186
MnlI CCTC 2 cut(s) 43, 77
Mox20I TGGCCA 1 cut(s) 186
MscI TGGCCA 1 cut(s) 186
Msp20I TGGCCA 1 cut(s) 186
MwoI GCNNNNNNNGC 1 cut(s) 133
NdeII GATC 1 cut(s) 145
NlaIII CATG 2 cut(s) 146, 191
PkrI GCNGC 1 cut(s) 138
SatI GCNGC 1 cut(s) 137
Sau3AI GATC 1 cut(s) 145
SetI ASST 3 cut(s) 119, 138, 160
SgeI CNNG 8 cut(s) 40, 64, 66, 75, 105, 140, 155, 167
Sse9I AATT 1 cut(s) 171
StyI CCWWGG 1 cut(s) 154
TasI AATT 1 cut(s) 171
TscAI CASTG 1 cut(s) 187
TseI GCWGC 1 cut(s) 136
TspRI CASTG 1 cut(s) 187
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.