RchiOBHm_Chr2g0167981

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
2
OG0001910
Physical Location & Seq
Forward (+)
82485182 .. 82494023
8842 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ53573

Sequence Viewer

Length: 363 bp
ATGATTTTTCGAAAACGTTTCCAATTTTATATAAAGCTTCCATTTTCGGAAACTTCCAAACTTATTTTCATTTCTTTCCCTTCTGGGAAACCATTGTCCCTTTCTCTCTCTTCCTCCCGCGTTCAAGACCGACGGAACTGGACGAATTTCGTCCGGTTAGTTCTTCCTCCTCCGGCCACCAATCCTCACCAAACTTCTTCCATTGGCTTCGTATGGTCCTTGCGCACCCGTCTGTGGTGGCCTTGCATGGCGGCGCGGCCTGTAGCGGCGGTGGTGATCTTGTTTCGATTTGAGTTCGATTTTAGGCAACGTCTGTTTTCTCCTAGCTCCGGCCACCAAAACTTCCGATCCTTAGCTCCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

120

Amino Acids

14.05

Weight (kDa)

11.94

Isoelectric Point (pI)

57.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc16I TGCGCA 1 cut(s) 224
AccII CGCG 2 cut(s) 120, 256
AciI CCGC 5 cut(s) 118, 251, 256, 266, 269
AclI AACGTT 1 cut(s) 16
AclWI GGATC 1 cut(s) 342
AcoI YGGCCR 2 cut(s) 174, 331
AcsI RAATTY 1 cut(s) 145
AfiI CCNNNNNNNGG 2 cut(s) 234, 329
AgsI TTSAA 1 cut(s) 125
AjuI GAANNNNNNNTTGG 2 cut(s) 50, 82
AluBI AGCT 3 cut(s) 37, 327, 356
AluI AGCT 3 cut(s) 37, 327, 356
AlwI GGATC 1 cut(s) 342
AoxI GGCC 4 cut(s) 174, 239, 257, 331
ApoI RAATTY 1 cut(s) 145
AspLEI GCGC 2 cut(s) 225, 256
AspS9I GGNCC 1 cut(s) 216
AsuHPI GGTGA 2 cut(s) 179, 286
AsuII TTCGAA 1 cut(s) 10
AvaII GGWCC 1 cut(s) 216
BfaI CTAG 1 cut(s) 324
BfmI CTRYAG 1 cut(s) 261
BisI GCNGC 3 cut(s) 252, 257, 267
BlsI GCNGC 3 cut(s) 253, 258, 268
Bme18I GGWCC 1 cut(s) 216
BmgT120I GGNCC 1 cut(s) 216
Bpu10I CCTNAGC 1 cut(s) 352
Bpu14I TTCGAA 1 cut(s) 10
BsaWI WCCGGW 1 cut(s) 153
Bsc4I CCNNNNNNNGG 2 cut(s) 234, 329
Bse1I ACTGG 1 cut(s) 143
BseLI CCNNNNNNNGG 2 cut(s) 234, 329
BseNI ACTGG 1 cut(s) 143
BseRI GAGGAG 1 cut(s) 159
Bsh1236I CGCG 2 cut(s) 120, 256
BshFI GGCC 4 cut(s) 176, 241, 259, 333
BsiSI CCGG 3 cut(s) 154, 173, 330
BslFI GGGAC 1 cut(s) 82
BslI CCNNNNNNNGG 2 cut(s) 234, 329
BsmFI GGGAC 1 cut(s) 82
BsnI GGCC 4 cut(s) 176, 241, 259, 333
Bsp119I TTCGAA 1 cut(s) 10
Bsp143I GATC 2 cut(s) 276, 347
BspACI CCGC 5 cut(s) 118, 251, 256, 266, 269
BspANI GGCC 4 cut(s) 176, 241, 259, 333
BspFNI CGCG 2 cut(s) 120, 256
BspPI GGATC 1 cut(s) 342
BspT104I TTCGAA 1 cut(s) 10
BsrI ACTGG 1 cut(s) 143
BssMI GATC 2 cut(s) 276, 347
Bst6I CTCTTC 1 cut(s) 115
BstBI TTCGAA 1 cut(s) 10
BstDEI CTNAG 1 cut(s) 352
BstFNI CGCG 2 cut(s) 120, 256
BstHHI GCGC 2 cut(s) 225, 256
BstKTI GATC 2 cut(s) 279, 350
BstMBI GATC 2 cut(s) 276, 347
BstSFI CTRYAG 1 cut(s) 261
BstUI CGCG 2 cut(s) 120, 256
BsuRI GGCC 4 cut(s) 176, 241, 259, 333
CfoI GCGC 2 cut(s) 225, 256
Cfr13I GGNCC 1 cut(s) 216
CviAII CATG 2 cut(s) 247, 360
CviJI RGCY 8 cut(s) 37, 176, 207, 241, 259, 327, 333, 356
CviKI_1 RGCY 8 cut(s) 37, 176, 207, 241, 259, 327, 333, 356
DdeI CTNAG 1 cut(s) 352
DpnI GATC 2 cut(s) 278, 349
DpnII GATC 2 cut(s) 276, 347
EaeI YGGCCR 2 cut(s) 174, 331
Eam1104I CTCTTC 1 cut(s) 115
EarI CTCTTC 1 cut(s) 115
Eco47I GGWCC 1 cut(s) 216
FaeI CATG 2 cut(s) 250, 363
FaiI YATR 5 cut(s) 30, 32, 214, 248, 361
FaqI GGGAC 1 cut(s) 82
FatI CATG 2 cut(s) 246, 359
FauI CCCGC 1 cut(s) 125
Fnu4HI GCNGC 3 cut(s) 252, 257, 267
Fsp4HI GCNGC 3 cut(s) 252, 257, 267
FspBI CTAG 1 cut(s) 324
FspI TGCGCA 1 cut(s) 224
GlaI GCGC 2 cut(s) 224, 255
GluI GCNGC 3 cut(s) 252, 257, 267
HaeIII GGCC 4 cut(s) 176, 241, 259, 333
HapII CCGG 3 cut(s) 154, 173, 330
HhaI GCGC 2 cut(s) 225, 256
Hin1II CATG 2 cut(s) 250, 363
Hin6I GCGC 2 cut(s) 223, 254
HinP1I GCGC 2 cut(s) 223, 254
HindIII AAGCTT 1 cut(s) 35
HpaII CCGG 3 cut(s) 154, 173, 330
HphI GGTGA 2 cut(s) 179, 286
Hpy188I TCNGA 2 cut(s) 49, 347
Hpy188III TCNNGA 1 cut(s) 125
Hpy99I CGWCG 1 cut(s) 135
HpyAV CCTTC 1 cut(s) 90
HpyCH4IV ACGT 2 cut(s) 16, 310
HpyCH4V TGCA 1 cut(s) 246
HpyF3I CTNAG 1 cut(s) 352
HpySE526I ACGT 2 cut(s) 16, 310
Hsp92II CATG 2 cut(s) 250, 363
HspAI GCGC 2 cut(s) 223, 254
Kzo9I GATC 2 cut(s) 276, 347
LmnI GCTCC 2 cut(s) 332, 361
LpnPI CCDG 6 cut(s) 69, 124, 167, 186, 273, 343
MaeI CTAG 1 cut(s) 324
MaeII ACGT 2 cut(s) 16, 310
MalI GATC 2 cut(s) 278, 349
MboI GATC 2 cut(s) 276, 347
MboII GAAGA 3 cut(s) 102, 155, 189
MluCI AATT 2 cut(s) 23, 145
MnlI CCTC 4 cut(s) 124, 177, 180, 195
MspI CCGG 3 cut(s) 154, 173, 330
MvnI CGCG 2 cut(s) 120, 256
NdeII GATC 2 cut(s) 276, 347
NlaIII CATG 2 cut(s) 250, 363
NsbI TGCGCA 1 cut(s) 224
NspV TTCGAA 1 cut(s) 10
PkrI GCNGC 3 cut(s) 253, 258, 268
Psp1406I AACGTT 1 cut(s) 16
PspPI GGNCC 1 cut(s) 216
SatI GCNGC 3 cut(s) 252, 257, 267
Sau3AI GATC 2 cut(s) 276, 347
Sau96I GGNCC 1 cut(s) 216
SetI ASST 5 cut(s) 19, 39, 313, 329, 358
SfcI CTRYAG 1 cut(s) 261
SfuI TTCGAA 1 cut(s) 10
SinI GGWCC 1 cut(s) 216
Sse9I AATT 2 cut(s) 23, 145
SsiI CCGC 5 cut(s) 118, 251, 256, 266, 269
SspMI CTAG 1 cut(s) 324
TaiI ACGT 2 cut(s) 19, 313
TaqI TCGA 3 cut(s) 10, 286, 297
TaqII GACCGA 1 cut(s) 144
TasI AATT 2 cut(s) 23, 145
TauI GCSGC 3 cut(s) 254, 259, 269
TspDTI ATGAA 1 cut(s) 58
TspGWI ACGGA 1 cut(s) 148
VpaK11BI GGWCC 1 cut(s) 216
XapI RAATTY 1 cut(s) 145
XspI CTAG 1 cut(s) 324
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.