Rmu_co8313989.1_g000001

Belongs to the ubiquitin-conjugating enzyme family

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8313989.1
Physical Location & Seq
Forward (+)
1 .. 928
928 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8313989.1_g000001.1.cds

Sequence Viewer

Length: 236 bp
actgactgggagggtgggtacttcccactcacacttcacttcagtgaagactaccctagcaagcctccaaagtgcaaattcccagcaaatttcttccacccgaatgtatatccatctggaactgtctgtctatcaatccttaatgaggacagtggttggagaccagcaattactgtgaagcaaattcttgtgggcattcaggatctactggatcagccaaatccctctgatcctgc

Protein Analysis

79

Amino Acids

8.82

Weight (kDa)

4.73

Isoelectric Point (pI)

54.92

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 3 cut(s) 210, 219, 224
AcsI RAATTY 3 cut(s) 77, 88, 183
AcuI CTGAAG 1 cut(s) 25
AfaI GTAC 1 cut(s) 20
AfiI CCNNNNNNNGG 1 cut(s) 145
AleI CACNNNNGTG 1 cut(s) 42
Alw26I GTCTC 1 cut(s) 154
AlwI GGATC 3 cut(s) 210, 219, 224
ApoI RAATTY 3 cut(s) 77, 88, 183
BbsI GAAGAC 1 cut(s) 54
BccI CCATC 1 cut(s) 121
BcoDI GTCTC 1 cut(s) 154
BfaI CTAG 1 cut(s) 57
BmrI ACTGGG 1 cut(s) 16
BmuI ACTGGG 1 cut(s) 16
BpiI GAAGAC 1 cut(s) 54
BsaI GGTCTC 1 cut(s) 154
BsaXI ACNNNNNCTCC 1 cut(s) 32
Bsc4I CCNNNNNNNGG 1 cut(s) 145
Bse1I ACTGG 2 cut(s) 11, 213
BseLI CCNNNNNNNGG 1 cut(s) 145
BseNI ACTGG 2 cut(s) 11, 213
BseYI CCCAGC 1 cut(s) 82
BslI CCNNNNNNNGG 1 cut(s) 145
BsmAI GTCTC 1 cut(s) 154
BsmI GAATGC 1 cut(s) 195
Bso31I GGTCTC 1 cut(s) 154
Bsp143I GATC 3 cut(s) 202, 211, 229
BspPI GGATC 3 cut(s) 210, 219, 224
BspTNI GGTCTC 1 cut(s) 154
BsrI ACTGG 2 cut(s) 11, 213
BssMI GATC 3 cut(s) 202, 211, 229
Bst4CI ACNGT 3 cut(s) 124, 152, 175
BstC8I GCNNGC 1 cut(s) 62
BstENI CCTNNNNNAGG 1 cut(s) 143
BstKTI GATC 3 cut(s) 205, 214, 232
BstMAI GTCTC 1 cut(s) 154
BstMBI GATC 3 cut(s) 202, 211, 229
BstV2I GAAGAC 1 cut(s) 54
BstX2I RGATCY 1 cut(s) 202
BstYI RGATCY 1 cut(s) 202
BtsIMutI CAGTG 2 cut(s) 49, 157
Cac8I GCNNGC 1 cut(s) 62
Csp6I GTAC 1 cut(s) 19
CviJI RGCY 2 cut(s) 64, 217
CviKI_1 RGCY 2 cut(s) 64, 217
CviQI GTAC 1 cut(s) 19
DpnI GATC 3 cut(s) 204, 213, 231
DpnII GATC 3 cut(s) 202, 211, 229
Eco31I GGTCTC 1 cut(s) 154
Eco57I CTGAAG 1 cut(s) 25
EcoNI CCTNNNNNAGG 1 cut(s) 143
FaiI YATR 1 cut(s) 109
FspBI CTAG 1 cut(s) 57
GsaI CCCAGC 1 cut(s) 86
Hpy188I TCNGA 1 cut(s) 229
Hpy188III TCNNGA 2 cut(s) 117, 200
HpyCH4III ACNGT 3 cut(s) 124, 152, 175
HpyCH4V TGCA 1 cut(s) 75
Kzo9I GATC 3 cut(s) 202, 211, 229
LpnPI CCDG 5 cut(s) 96, 102, 177, 185, 194
MaeI CTAG 1 cut(s) 57
MalI GATC 3 cut(s) 204, 213, 231
MboI GATC 3 cut(s) 202, 211, 229
MboII GAAGA 2 cut(s) 59, 85
MflI RGATCY 1 cut(s) 202
MluCI AATT 4 cut(s) 77, 88, 168, 183
MmeI TCCRAC 1 cut(s) 137
MnlI CCTC 4 cut(s) 4, 75, 139, 235
MseI TTAA 1 cut(s) 141
MslI CAYNNNNRTG 2 cut(s) 42, 102
Mva1269I GAATGC 1 cut(s) 195
NdeII GATC 3 cut(s) 202, 211, 229
OliI CACNNNNGTG 1 cut(s) 42
PctI GAATGC 1 cut(s) 195
PspFI CCCAGC 1 cut(s) 82
PsuI RGATCY 1 cut(s) 202
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
RseI CAYNNNNRTG 2 cut(s) 42, 102
SaqAI TTAA 1 cut(s) 141
Sau3AI GATC 3 cut(s) 202, 211, 229
SmiMI CAYNNNNRTG 2 cut(s) 42, 102
Sse9I AATT 4 cut(s) 77, 88, 168, 183
SspMI CTAG 1 cut(s) 57
TaaI ACNGT 3 cut(s) 124, 152, 175
TasI AATT 4 cut(s) 77, 88, 168, 183
Tru1I TTAA 1 cut(s) 141
Tru9I TTAA 1 cut(s) 141
TscAI CASTG 2 cut(s) 49, 157
TspRI CASTG 2 cut(s) 49, 157
XagI CCTNNNNNAGG 1 cut(s) 143
XapI RAATTY 3 cut(s) 77, 88, 183
XspI CTAG 1 cut(s) 57
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.