RchiOBHm_Chr3g0456221

Multiple C2 and transmembrane domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_chinensis
3
Physical Location & Seq
Forward (+)
5800214 .. 5800925
712 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ42307

Sequence Viewer

Length: 240 bp
ATGACTGTGAGCAACAGCACCGGCAAAGAATGCCTTGTGGTGGAGGTGGTGGCGGCCCACAACCTTATGCCCAAAGACGGTGAAGGCTCATCGTCCCCATTCGTCGAAATTGAATTTGAAAACCAGAGGCTCCGAACCCAGGTCAAGTACAAGGACCTGAACCCGGTCAGGAACCTCAAATTTAAAAAATGGGGACCTAACCTTCTGCAAAAATCAATAAAAGCCCAGATTTCAGATTAA

Protein Analysis

79

Amino Acids

8.92

Weight (kDa)

9.21

Isoelectric Point (pI)

44.37

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
C2 PF00168 12 - 77 3.6e-11 C2 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 53
AcsI RAATTY 2 cut(s) 113, 179
AfaI GTAC 1 cut(s) 149
AfiI CCNNNNNNNGG 4 cut(s) 40, 77, 139, 163
AgsI TTSAA 2 cut(s) 113, 119
AjnI CCWGG 1 cut(s) 138
AoxI GGCC 1 cut(s) 54
ApoI RAATTY 2 cut(s) 113, 179
AspS9I GGNCC 3 cut(s) 55, 154, 194
AsuC2I CCSGG 1 cut(s) 164
AsuHPI GGTGA 1 cut(s) 92
AvaII GGWCC 2 cut(s) 154, 194
BciT130I CCWGG 1 cut(s) 140
BcnI CCSGG 1 cut(s) 164
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
Bme1390I CCNGG 2 cut(s) 140, 164
Bme18I GGWCC 2 cut(s) 154, 194
BmgT120I GGNCC 3 cut(s) 55, 154, 194
BmiI GGNNCC 3 cut(s) 131, 173, 195
BmrFI CCNGG 2 cut(s) 140, 164
BpuMI CCSGG 1 cut(s) 164
BsaJI CCNNGG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 4 cut(s) 40, 77, 139, 163
Bse118I RCCGGY 1 cut(s) 20
BseBI CCWGG 1 cut(s) 140
BseDI CCNNGG 1 cut(s) 138
BseLI CCNNNNNNNGG 4 cut(s) 40, 77, 139, 163
BshFI GGCC 1 cut(s) 56
BsiSI CCGG 2 cut(s) 21, 164
BslFI GGGAC 2 cut(s) 79, 207
BslI CCNNNNNNNGG 4 cut(s) 40, 77, 139, 163
BsmFI GGGAC 2 cut(s) 79, 207
BsmI GAATGC 1 cut(s) 35
BsnI GGCC 1 cut(s) 56
BspACI CCGC 1 cut(s) 53
BspANI GGCC 1 cut(s) 56
BspLI GGNNCC 3 cut(s) 131, 173, 195
BsrFI RCCGGY 1 cut(s) 20
BssAI RCCGGY 1 cut(s) 20
BssECI CCNNGG 1 cut(s) 138
Bst2UI CCWGG 1 cut(s) 140
Bst4CI ACNGT 2 cut(s) 7, 80
BstAPI GCANNNNNTGC 1 cut(s) 30
BstMWI GCNNNNNNNGC 1 cut(s) 30
BstNI CCWGG 1 cut(s) 140
BstSCI CCNGG 2 cut(s) 138, 162
BsuRI GGCC 1 cut(s) 56
Cfr10I RCCGGY 1 cut(s) 20
Cfr13I GGNCC 3 cut(s) 55, 154, 194
Csp6I GTAC 1 cut(s) 148
CviJI RGCY 4 cut(s) 56, 87, 130, 224
CviKI_1 RGCY 4 cut(s) 56, 87, 130, 224
CviQI GTAC 1 cut(s) 148
DraI TTTAAA 1 cut(s) 184
Eco47I GGWCC 2 cut(s) 154, 194
EcoO109I RGGNCCY 2 cut(s) 154, 194
EcoRII CCWGG 1 cut(s) 138
FaiI YATR 1 cut(s) 68
FalI AAGNNNNNCTT 2 cut(s) 18, 50
FaqI GGGAC 2 cut(s) 79, 207
Fnu4HI GCNGC 1 cut(s) 54
Fsp4HI GCNGC 1 cut(s) 54
GluI GCNGC 1 cut(s) 54
HaeIII GGCC 1 cut(s) 56
HapII CCGG 2 cut(s) 21, 164
HpaII CCGG 2 cut(s) 21, 164
HphI GGTGA 1 cut(s) 92
Hpy188I TCNGA 2 cut(s) 134, 235
Hpy188III TCNNGA 1 cut(s) 169
Hpy99I CGWCG 1 cut(s) 107
HpyAV CCTTC 2 cut(s) 77, 212
HpyCH4III ACNGT 2 cut(s) 7, 80
HpyCH4V TGCA 1 cut(s) 208
HpyF10VI GCNNNNNNNGC 1 cut(s) 30
LmnI GCTCC 1 cut(s) 135
LpnPI CCDG 7 cut(s) 34, 125, 137, 152, 154, 170, 177
MluCI AATT 3 cut(s) 108, 113, 179
MnlI CCTC 3 cut(s) 37, 120, 185
MseI TTAA 2 cut(s) 183, 238
MspI CCGG 2 cut(s) 21, 164
MspR9I CCNGG 2 cut(s) 140, 164
Mva1269I GAATGC 1 cut(s) 35
MvaI CCWGG 1 cut(s) 140
MwoI GCNNNNNNNGC 1 cut(s) 30
NciI CCSGG 1 cut(s) 164
NlaIV GGNNCC 3 cut(s) 131, 173, 195
PctI GAATGC 1 cut(s) 35
PkrI GCNGC 1 cut(s) 55
PpuMI RGGWCCY 2 cut(s) 154, 194
Psp5II RGGWCCY 2 cut(s) 154, 194
Psp6I CCWGG 1 cut(s) 138
PspGI CCWGG 1 cut(s) 138
PspN4I GGNNCC 3 cut(s) 131, 173, 195
PspPI GGNCC 3 cut(s) 55, 154, 194
PspPPI RGGWCCY 2 cut(s) 154, 194
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
SaqAI TTAA 2 cut(s) 183, 238
SatI GCNGC 1 cut(s) 54
Sau96I GGNCC 3 cut(s) 55, 154, 194
ScrFI CCNGG 2 cut(s) 140, 164
SetI ASST 7 cut(s) 48, 66, 144, 159, 177, 199, 204
SinI GGWCC 2 cut(s) 154, 194
Sse9I AATT 3 cut(s) 108, 113, 179
SsiI CCGC 1 cut(s) 53
StyD4I CCNGG 2 cut(s) 138, 162
TaaI ACNGT 2 cut(s) 7, 80
TaqI TCGA 1 cut(s) 105
TasI AATT 3 cut(s) 108, 113, 179
TatI WGTACW 1 cut(s) 147
TauI GCSGC 1 cut(s) 56
Tru1I TTAA 2 cut(s) 183, 238
Tru9I TTAA 2 cut(s) 183, 238
VpaK11BI GGWCC 2 cut(s) 154, 194
XapI RAATTY 2 cut(s) 113, 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.