Rh5DG311600

Multiple C2 and transmembrane domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr5D
Physical Location & Seq
Reverse (-)
39853870 .. 39859668
5799 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh5DG311600.1

Sequence Viewer

Length: 249 bp
ATGACTGTGAGCAACAGTACCGACAAAGAACGCCTTGTGGTGAAGGTTGTGGCGGCCCACAACCTCATGCCCAAAGACGGCGAAGGCTCATCGTCCCCATTCGTCGAAATCGAATTTGAAAACCAGAGGCTCCGAACCCAGGTCAAGTACAAGGACCTGAACCCCATCGTCGTTTCGAAAATTGGAATTGGTTGGATTGAGAAGCACACTAGAAATGTTTCGGAAACCCAGATTCCAATTCAAGCTTAG

Protein Analysis

82

Amino Acids

9.23

Weight (kDa)

8.08

Isoelectric Point (pI)

37.82

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
C2 PF00168 11 - 56 2.5e-10 C2 domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 53
AcsI RAATTY 1 cut(s) 113
AfaI GTAC 2 cut(s) 19, 149
AfiI CCNNNNNNNGG 2 cut(s) 77, 139
AgsI TTSAA 2 cut(s) 119, 242
AjnI CCWGG 1 cut(s) 138
AluBI AGCT 1 cut(s) 245
AluI AGCT 1 cut(s) 245
AoxI GGCC 1 cut(s) 54
ApoI RAATTY 1 cut(s) 113
Asp700I GAANNNNTTC 1 cut(s) 217
AspS9I GGNCC 2 cut(s) 55, 154
AsuHPI GGTGA 1 cut(s) 52
AsuII TTCGAA 1 cut(s) 176
AvaII GGWCC 1 cut(s) 154
BccI CCATC 1 cut(s) 173
BceAI ACGGC 1 cut(s) 94
BciT130I CCWGG 1 cut(s) 140
BfaI CTAG 1 cut(s) 210
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
Bme1390I CCNGG 1 cut(s) 140
Bme18I GGWCC 1 cut(s) 154
BmgT120I GGNCC 2 cut(s) 55, 154
BmiI GGNNCC 1 cut(s) 131
BmrFI CCNGG 1 cut(s) 140
Bpu14I TTCGAA 1 cut(s) 176
BsaJI CCNNGG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 2 cut(s) 77, 139
BseBI CCWGG 1 cut(s) 140
BseDI CCNNGG 1 cut(s) 138
BseLI CCNNNNNNNGG 2 cut(s) 77, 139
BshFI GGCC 1 cut(s) 56
BslFI GGGAC 1 cut(s) 79
BslI CCNNNNNNNGG 2 cut(s) 77, 139
BsmFI GGGAC 1 cut(s) 79
BsnI GGCC 1 cut(s) 56
Bsp119I TTCGAA 1 cut(s) 176
BspACI CCGC 1 cut(s) 53
BspANI GGCC 1 cut(s) 56
BspLI GGNNCC 1 cut(s) 131
BspT104I TTCGAA 1 cut(s) 176
BssECI CCNNGG 1 cut(s) 138
Bst2UI CCWGG 1 cut(s) 140
Bst4CI ACNGT 2 cut(s) 7, 17
BstBI TTCGAA 1 cut(s) 176
BstDEI CTNAG 1 cut(s) 246
BstNI CCWGG 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 138
BsuRI GGCC 1 cut(s) 56
Cfr13I GGNCC 2 cut(s) 55, 154
Csp6I GTAC 2 cut(s) 18, 148
CviAII CATG 1 cut(s) 67
CviJI RGCY 4 cut(s) 56, 87, 130, 245
CviKI_1 RGCY 4 cut(s) 56, 87, 130, 245
CviQI GTAC 2 cut(s) 18, 148
DdeI CTNAG 1 cut(s) 246
Eco47I GGWCC 1 cut(s) 154
EcoO109I RGGNCCY 1 cut(s) 154
EcoRII CCWGG 1 cut(s) 138
FaeI CATG 1 cut(s) 70
FaiI YATR 1 cut(s) 68
FalI AAGNNNNNCTT 2 cut(s) 18, 50
FaqI GGGAC 1 cut(s) 79
FatI CATG 1 cut(s) 66
Fnu4HI GCNGC 1 cut(s) 54
Fsp4HI GCNGC 1 cut(s) 54
FspBI CTAG 1 cut(s) 210
GluI GCNGC 1 cut(s) 54
HaeIII GGCC 1 cut(s) 56
Hin1II CATG 1 cut(s) 70
HindIII AAGCTT 1 cut(s) 243
HinfI GANTC 1 cut(s) 232
HphI GGTGA 1 cut(s) 52
Hpy188I TCNGA 2 cut(s) 134, 223
Hpy99I CGWCG 2 cut(s) 107, 173
HpyAV CCTTC 2 cut(s) 37, 77
HpyCH4III ACNGT 2 cut(s) 7, 17
HpyF3I CTNAG 1 cut(s) 246
Hsp92II CATG 1 cut(s) 70
LmnI GCTCC 1 cut(s) 135
LpnPI CCDG 5 cut(s) 125, 137, 152, 170, 242
MaeI CTAG 1 cut(s) 210
MluCI AATT 4 cut(s) 113, 180, 186, 237
MmeI TCCRAC 1 cut(s) 173
MnlI CCTC 2 cut(s) 74, 120
MroXI GAANNNNTTC 1 cut(s) 217
MspR9I CCNGG 1 cut(s) 140
MvaI CCWGG 1 cut(s) 140
NlaIII CATG 1 cut(s) 70
NlaIV GGNNCC 1 cut(s) 131
NspV TTCGAA 1 cut(s) 176
PcsI WCGNNNNNNNCGW 1 cut(s) 108
PdmI GAANNNNTTC 1 cut(s) 217
PfeI GAWTC 1 cut(s) 232
PkrI GCNGC 1 cut(s) 55
PpuMI RGGWCCY 1 cut(s) 154
Psp5II RGGWCCY 1 cut(s) 154
Psp6I CCWGG 1 cut(s) 138
PspGI CCWGG 1 cut(s) 138
PspN4I GGNNCC 1 cut(s) 131
PspPI GGNCC 2 cut(s) 55, 154
PspPPI RGGWCCY 1 cut(s) 154
RsaI GTAC 2 cut(s) 19, 149
RsaNI GTAC 2 cut(s) 18, 148
SatI GCNGC 1 cut(s) 54
Sau96I GGNCC 2 cut(s) 55, 154
ScrFI CCNGG 1 cut(s) 140
SetI ASST 5 cut(s) 48, 66, 144, 159, 247
SfuI TTCGAA 1 cut(s) 176
SinI GGWCC 1 cut(s) 154
Sse9I AATT 4 cut(s) 113, 180, 186, 237
SsiI CCGC 1 cut(s) 53
SspMI CTAG 1 cut(s) 210
StyD4I CCNGG 1 cut(s) 138
TaaI ACNGT 2 cut(s) 7, 17
TaqI TCGA 3 cut(s) 105, 111, 176
TasI AATT 4 cut(s) 113, 180, 186, 237
TatI WGTACW 1 cut(s) 147
TauI GCSGC 1 cut(s) 56
TfiI GAWTC 1 cut(s) 232
VpaK11BI GGWCC 1 cut(s) 154
XapI RAATTY 1 cut(s) 113
XmnI GAANNNNTTC 1 cut(s) 217
XspI CTAG 1 cut(s) 210
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.