Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0002026.1

Orthogroup ID

OG0007540

Physical Location & Seq

Genomic Coordinates Reverse (-)

90853 .. 91413

Gene Structure 561 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0002026.1_g000018.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 261 bp

atgactgtgagcaacagtaccggcaaagaacgccttatggtggaggttgtgggggcccacaacctcatgttggacggcgaaggctcatcgtccccattcgtcgaaatcgaatttgaaaaccagaggctccgaacccaggtcaagtacaaggacctgaaccccatcgtcgtttcgaaaattggaattgggaacccggtctggaacgagaagctagtctttcgtgtcaaggacgtggctgatcttccctacagagccatatag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0001505 GO:0003674 GO:0005488 GO:0005509 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005783 GO:0005789 GO:0007154 GO:0007165 GO:0008021 GO:0008150 GO:0009987 GO:0010646 GO:0012505 GO:0012506 GO:0016020 GO:0016021 GO:0019722 GO:0019932 GO:0023051 GO:0023052 GO:0030100 GO:0030133 GO:0030334 GO:0030336 GO:0030658 GO:0030659 GO:0030672 GO:0031090 GO:0031224 GO:0031410 GO:0031982 GO:0031984 GO:0032879 GO:0035556 GO:0040012 GO:0040013 GO:0042175 GO:0043167 GO:0043169 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044433 GO:0044444 GO:0044446 GO:0044456 GO:0044464 GO:0045202 GO:0045806 GO:0046872 GO:0046928 GO:0048167 GO:0048168 GO:0048519 GO:0048523 GO:0048583 GO:0048585 GO:0050789 GO:0050794 GO:0050804 GO:0050896 GO:0051046 GO:0051049 GO:0051051 GO:0051128 GO:0051129 GO:0051270 GO:0051271 GO:0051588 GO:0051716 GO:0055037 GO:0060341 GO:0060627 GO:0065007 GO:0065008 GO:0070382 GO:0080134 GO:0097458 GO:0097708 GO:0098588 GO:0098793 GO:0098805 GO:0098827 GO:0099177 GO:0099501 GO:0099503 GO:1902882 GO:1902883 GO:1903530 GO:2000145 GO:2000146

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

C2 PRT_C

Protein Analysis

86

Amino Acids

9.68

Weight (kDa)

6.57

Isoelectric Point (pI)

21.96

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007540)

Species	Orthologous Gene IDs
pyrus_communis	pycom12g00960 pycom15g36380
rosa_chinensis	RchiOBHm_Chr3g0456221 RchiOBHm_Chr4g0400961
rosa_multiflora	Rmu_sc0002026.1_g000018 Rmu_sc0002170.1_g000056 Rmu_sc0002351.1_g000029 Rmu_sc0012757.1_g000004 Rmu_sc0014856.1_g000002 Rmu_sc0040516.1_g000001 Rmu_sc0040517.1_g000001 Rmu_ssc0000162.1_g000020
rosa_roxburghii	Rroxscaffold_1G00044730 Rroxscaffold_3G00230760
rosa_rugosa	Rorug04G0155200
rosa_samantha	Rh4AG104900 Rh4CG113400 Rh5BG302900 Rh5CG210400 Rh5CG352600 Rh5DG311600 Rh6AG346300 Rh6CG066900 Rh6CG360200 Rh7BG027700

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcsI	RAATTY	1 cut(s)	110
AfaI	GTAC	2 cut(s)	19, 146
AfiI	CCNNNNNNNGG	3 cut(s)	40, 70, 136
AgsI	TTSAA	1 cut(s)	116
AjiI	CACGTC	1 cut(s)	232
AjnI	CCWGG	1 cut(s)	135
AluBI	AGCT	1 cut(s)	211
AluI	AGCT	1 cut(s)	211
AoxI	GGCC	1 cut(s)	54
ApaI	GGGCCC	1 cut(s)	58
ApoI	RAATTY	1 cut(s)	110
AspS9I	GGNCC	3 cut(s)	54, 55, 151
AsuC2I	CCSGG	1 cut(s)	194
AsuII	TTCGAA	1 cut(s)	173
AvaII	GGWCC	1 cut(s)	151
BaeGI	GKGCMC	1 cut(s)	58
BanII	GRGCYC	1 cut(s)	58
BccI	CCATC	1 cut(s)	170
BceAI	ACGGC	1 cut(s)	91
BciT130I	CCWGG	1 cut(s)	137
BcnI	CCSGG	1 cut(s)	194
BfaI	CTAG	1 cut(s)	212
BfmI	CTRYAG	1 cut(s)	247
Bme1390I	CCNGG	2 cut(s)	137, 194
Bme18I	GGWCC	1 cut(s)	151
BmgBI	CACGTC	1 cut(s)	232
BmgT120I	GGNCC	3 cut(s)	54, 55, 151
BmiI	GGNNCC	4 cut(s)	55, 56, 128, 191
BmrFI	CCNGG	2 cut(s)	137, 194
Bpu14I	TTCGAA	1 cut(s)	173
BpuMI	CCSGG	1 cut(s)	194
BsaJI	CCNNGG	1 cut(s)	135
Bsc4I	CCNNNNNNNGG	3 cut(s)	40, 70, 136
Bse118I	RCCGGY	1 cut(s)	20
BseBI	CCWGG	1 cut(s)	137
BseDI	CCNNGG	1 cut(s)	135
BseLI	CCNNNNNNNGG	3 cut(s)	40, 70, 136
BseSI	GKGCMC	1 cut(s)	58
BshFI	GGCC	1 cut(s)	56
BsiSI	CCGG	2 cut(s)	21, 194
BslFI	GGGAC	1 cut(s)	76
BslI	CCNNNNNNNGG	3 cut(s)	40, 70, 136
BsmFI	GGGAC	1 cut(s)	76
BsnI	GGCC	1 cut(s)	56
Bsp119I	TTCGAA	1 cut(s)	173
Bsp120I	GGGCCC	1 cut(s)	54
Bsp1286I	GDGCHC	1 cut(s)	58
Bsp143I	GATC	1 cut(s)	238
BspANI	GGCC	1 cut(s)	56
BspLI	GGNNCC	4 cut(s)	55, 56, 128, 191
BspT104I	TTCGAA	1 cut(s)	173
BsrFI	RCCGGY	1 cut(s)	20
BssAI	RCCGGY	1 cut(s)	20
BssECI	CCNNGG	1 cut(s)	135
BssMI	GATC	1 cut(s)	238
Bst2UI	CCWGG	1 cut(s)	137
Bst4CI	ACNGT	2 cut(s)	7, 17
BstBI	TTCGAA	1 cut(s)	173
BstKTI	GATC	1 cut(s)	241
BstMBI	GATC	1 cut(s)	238
BstMWI	GCNNNNNNNGC	1 cut(s)	30
BstNI	CCWGG	1 cut(s)	137
BstSCI	CCNGG	2 cut(s)	135, 192
BstSFI	CTRYAG	1 cut(s)	247
BstSLI	GKGCMC	1 cut(s)	58
BsuRI	GGCC	1 cut(s)	56
BtrI	CACGTC	1 cut(s)	232
Cfr10I	RCCGGY	1 cut(s)	20
Cfr13I	GGNCC	3 cut(s)	54, 55, 151
Csp6I	GTAC	2 cut(s)	18, 145
CviAII	CATG	1 cut(s)	67
CviJI	RGCY	6 cut(s)	56, 84, 127, 211, 236, 254
CviKI_1	RGCY	6 cut(s)	56, 84, 127, 211, 236, 254
CviQI	GTAC	2 cut(s)	18, 145
DpnI	GATC	1 cut(s)	240
DpnII	GATC	1 cut(s)	238
Eco24I	GRGCYC	1 cut(s)	58
Eco47I	GGWCC	1 cut(s)	151
EcoO109I	RGGNCCY	2 cut(s)	54, 151
EcoRII	CCWGG	1 cut(s)	135
EcoT38I	GRGCYC	1 cut(s)	58
FaeI	CATG	1 cut(s)	70
FaiI	YATR	4 cut(s)	38, 68, 257, 259
FalI	AAGNNNNNCTT	4 cut(s)	18, 50, 200, 232
FaqI	GGGAC	1 cut(s)	76
FatI	CATG	1 cut(s)	66
FriOI	GRGCYC	1 cut(s)	58
FspBI	CTAG	1 cut(s)	212
HaeIII	GGCC	1 cut(s)	56
HapII	CCGG	2 cut(s)	21, 194
Hin1II	CATG	1 cut(s)	70
HpaII	CCGG	2 cut(s)	21, 194
Hpy188I	TCNGA	1 cut(s)	131
Hpy188III	TCNNGA	1 cut(s)	199
Hpy99I	CGWCG	2 cut(s)	104, 170
HpyAV	CCTTC	1 cut(s)	74
HpyCH4III	ACNGT	2 cut(s)	7, 17
HpyCH4IV	ACGT	1 cut(s)	231
HpyF10VI	GCNNNNNNNGC	1 cut(s)	30
HpySE526I	ACGT	1 cut(s)	231
Hsp92II	CATG	1 cut(s)	70
Kzo9I	GATC	1 cut(s)	238
LmnI	GCTCC	1 cut(s)	132
LpnPI	CCDG	7 cut(s)	34, 122, 134, 149, 167, 184, 207
MaeI	CTAG	1 cut(s)	212
MaeII	ACGT	1 cut(s)	231
MalI	GATC	1 cut(s)	240
MboI	GATC	1 cut(s)	238
MboII	GAAGA	1 cut(s)	233
MhlI	GDGCHC	1 cut(s)	58
MluCI	AATT	3 cut(s)	110, 177, 183
MmeI	TCCRAC	1 cut(s)	51
MnlI	CCTC	3 cut(s)	37, 74, 117
MspI	CCGG	2 cut(s)	21, 194
MspR9I	CCNGG	2 cut(s)	137, 194
MvaI	CCWGG	1 cut(s)	137
MwoI	GCNNNNNNNGC	1 cut(s)	30
NciI	CCSGG	1 cut(s)	194
NdeII	GATC	1 cut(s)	238
NlaIII	CATG	1 cut(s)	70
NlaIV	GGNNCC	4 cut(s)	55, 56, 128, 191
NspV	TTCGAA	1 cut(s)	173
PcsI	WCGNNNNNNNCGW	1 cut(s)	105
PpuMI	RGGWCCY	1 cut(s)	151
Psp5II	RGGWCCY	1 cut(s)	151
Psp6I	CCWGG	1 cut(s)	135
PspGI	CCWGG	1 cut(s)	135
PspN4I	GGNNCC	4 cut(s)	55, 56, 128, 191
PspOMI	GGGCCC	1 cut(s)	54
PspPI	GGNCC	3 cut(s)	54, 55, 151
PspPPI	RGGWCCY	1 cut(s)	151
RsaI	GTAC	2 cut(s)	19, 146
RsaNI	GTAC	2 cut(s)	18, 145
Sau3AI	GATC	1 cut(s)	238
Sau96I	GGNCC	3 cut(s)	54, 55, 151
ScrFI	CCNGG	2 cut(s)	137, 194
SduI	GDGCHC	1 cut(s)	58
SetI	ASST	6 cut(s)	48, 66, 141, 156, 213, 234
SfcI	CTRYAG	1 cut(s)	247
SfuI	TTCGAA	1 cut(s)	173
SinI	GGWCC	1 cut(s)	151
Sse9I	AATT	3 cut(s)	110, 177, 183
SspMI	CTAG	1 cut(s)	212
StyD4I	CCNGG	2 cut(s)	135, 192
TaaI	ACNGT	2 cut(s)	7, 17
TaiI	ACGT	1 cut(s)	234
TaqI	TCGA	3 cut(s)	102, 108, 173
TasI	AATT	3 cut(s)	110, 177, 183
TatI	WGTACW	1 cut(s)	144
VpaK11BI	GGWCC	1 cut(s)	151
XapI	RAATTY	1 cut(s)	110
XspI	CTAG	1 cut(s)	212

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.