Rmu_sc0002351.1_g000029

Multiple C2 and transmembrane domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0002351.1
Physical Location & Seq
Reverse (-)
95881 .. 96120
240 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0002351.1_g000029.1.cds

Sequence Viewer

Length: 240 bp
atgactatgagcaacaagaccgacaaagaatgccttgtggtggaggtggtggcggcccacaacctcatgcccaaagacggcaaaggctcattgtccccattcgtcgaaatcgaatttgaaaaccagaggctccaaacccaggtcaagtacaatgacctgaacccgatctggaacctcaaatttaaaaaatggggacctaaccttcagcaaaaatcaataaaagcccagatttcgtattaa

Protein Analysis

79

Amino Acids

9.14

Weight (kDa)

9.13

Isoelectric Point (pI)

49.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 53
AcsI RAATTY 2 cut(s) 113, 179
AcuI CTGAAG 1 cut(s) 188
AfaI GTAC 1 cut(s) 149
AfiI CCNNNNNNNGG 3 cut(s) 40, 77, 139
AgsI TTSAA 1 cut(s) 119
AjnI CCWGG 1 cut(s) 138
AoxI GGCC 1 cut(s) 54
ApoI RAATTY 2 cut(s) 113, 179
AspS9I GGNCC 2 cut(s) 55, 194
AvaII GGWCC 1 cut(s) 194
BceAI ACGGC 1 cut(s) 94
BciT130I CCWGG 1 cut(s) 140
BisI GCNGC 1 cut(s) 54
BlsI GCNGC 1 cut(s) 55
Bme1390I CCNGG 1 cut(s) 140
Bme18I GGWCC 1 cut(s) 194
BmgT120I GGNCC 2 cut(s) 55, 194
BmiI GGNNCC 3 cut(s) 131, 173, 195
BmrFI CCNGG 1 cut(s) 140
BsaJI CCNNGG 1 cut(s) 138
Bsc4I CCNNNNNNNGG 3 cut(s) 40, 77, 139
BseBI CCWGG 1 cut(s) 140
BseDI CCNNGG 1 cut(s) 138
BseLI CCNNNNNNNGG 3 cut(s) 40, 77, 139
BshFI GGCC 1 cut(s) 56
BslFI GGGAC 2 cut(s) 79, 207
BslI CCNNNNNNNGG 3 cut(s) 40, 77, 139
BsmFI GGGAC 2 cut(s) 79, 207
BsmI GAATGC 1 cut(s) 35
BsnI GGCC 1 cut(s) 56
Bsp143I GATC 1 cut(s) 165
BspACI CCGC 1 cut(s) 53
BspANI GGCC 1 cut(s) 56
BspLI GGNNCC 3 cut(s) 131, 173, 195
BssECI CCNNGG 1 cut(s) 138
BssMI GATC 1 cut(s) 165
Bst2UI CCWGG 1 cut(s) 140
BstKTI GATC 1 cut(s) 168
BstMBI GATC 1 cut(s) 165
BstNI CCWGG 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 138
BsuRI GGCC 1 cut(s) 56
Cfr13I GGNCC 2 cut(s) 55, 194
Csp6I GTAC 1 cut(s) 148
CviAII CATG 1 cut(s) 67
CviJI RGCY 4 cut(s) 56, 87, 130, 224
CviKI_1 RGCY 4 cut(s) 56, 87, 130, 224
CviQI GTAC 1 cut(s) 148
DpnI GATC 1 cut(s) 167
DpnII GATC 1 cut(s) 165
DraI TTTAAA 1 cut(s) 184
Eco47I GGWCC 1 cut(s) 194
Eco57I CTGAAG 1 cut(s) 188
EcoO109I RGGNCCY 1 cut(s) 194
EcoRII CCWGG 1 cut(s) 138
FaeI CATG 1 cut(s) 70
FaiI YATR 2 cut(s) 8, 68
FalI AAGNNNNNCTT 2 cut(s) 18, 50
FaqI GGGAC 2 cut(s) 79, 207
FatI CATG 1 cut(s) 66
Fnu4HI GCNGC 1 cut(s) 54
Fsp4HI GCNGC 1 cut(s) 54
GluI GCNGC 1 cut(s) 54
HaeIII GGCC 1 cut(s) 56
Hin1II CATG 1 cut(s) 70
Hpy188III TCNNGA 1 cut(s) 169
Hpy99I CGWCG 1 cut(s) 107
HpyAV CCTTC 1 cut(s) 212
Hsp92II CATG 1 cut(s) 70
Kzo9I GATC 1 cut(s) 165
LmnI GCTCC 1 cut(s) 135
LpnPI CCDG 5 cut(s) 125, 137, 152, 154, 170
MalI GATC 1 cut(s) 167
MboI GATC 1 cut(s) 165
MluCI AATT 2 cut(s) 113, 179
MnlI CCTC 4 cut(s) 37, 74, 120, 185
MseI TTAA 2 cut(s) 183, 238
MspR9I CCNGG 1 cut(s) 140
Mva1269I GAATGC 1 cut(s) 35
MvaI CCWGG 1 cut(s) 140
NdeII GATC 1 cut(s) 165
NlaIII CATG 1 cut(s) 70
NlaIV GGNNCC 3 cut(s) 131, 173, 195
PcsI WCGNNNNNNNCGW 1 cut(s) 108
PctI GAATGC 1 cut(s) 35
PkrI GCNGC 1 cut(s) 55
PpuMI RGGWCCY 1 cut(s) 194
Psp5II RGGWCCY 1 cut(s) 194
Psp6I CCWGG 1 cut(s) 138
PspGI CCWGG 1 cut(s) 138
PspN4I GGNNCC 3 cut(s) 131, 173, 195
PspPI GGNCC 2 cut(s) 55, 194
PspPPI RGGWCCY 1 cut(s) 194
RsaI GTAC 1 cut(s) 149
RsaNI GTAC 1 cut(s) 148
SaqAI TTAA 2 cut(s) 183, 238
SatI GCNGC 1 cut(s) 54
Sau3AI GATC 1 cut(s) 165
Sau96I GGNCC 2 cut(s) 55, 194
ScrFI CCNGG 1 cut(s) 140
SetI ASST 7 cut(s) 48, 66, 144, 159, 177, 199, 204
SinI GGWCC 1 cut(s) 194
Sse9I AATT 2 cut(s) 113, 179
SsiI CCGC 1 cut(s) 53
StyD4I CCNGG 1 cut(s) 138
TaqI TCGA 2 cut(s) 105, 111
TaqII GACCGA 1 cut(s) 35
TasI AATT 2 cut(s) 113, 179
TatI WGTACW 1 cut(s) 147
TauI GCSGC 1 cut(s) 56
Tru1I TTAA 2 cut(s) 183, 238
Tru9I TTAA 2 cut(s) 183, 238
VpaK11BI GGWCC 1 cut(s) 194
XapI RAATTY 2 cut(s) 113, 179
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.