RchiOBHm_Chr4g0428791

Aux IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations

Basic Information

Type: gene
Biological Identity
rosa_chinensis
4
Physical Location & Seq
Reverse (-)
53746817 .. 53747316
500 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ39764

Sequence Viewer

Length: 300 bp
ATGGAGGGAATCCCAATTGGCAGAAAAGTGAATCTGTTTGCTCATGATGGTTATGATGCTTTAATCACATCTCTGAGCCTCATGTTCAAGATCACCATTCTATGTCCTGATCAAGTTTATTCAGAGAAAAATTATGTGTTAACTTACGAAGATCAAGAAGGGGATTGGATGCTGGTTGGAGATGTGCCTTGGGAGATATTCTTGACTAGTGTGAAAAAATTGATGATCACTAGAGTGGACAGATGTGGAAGCAGCTGGAATACTCCGAGAGAGAAAGTGGCAACCAAGGACCGTCGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

99

Amino Acids

11.45

Weight (kDa)

5.76

Isoelectric Point (pI)

20.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AUX_IAA PF02309 1 - 78 2.2e-23 AUX/IAA family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 88
AhlI ACTAGT 1 cut(s) 206
AleI CACNNNNGTG 1 cut(s) 233
AluBI AGCT 1 cut(s) 255
AluI AGCT 1 cut(s) 255
ApeKI GCWGC 1 cut(s) 252
AspS9I GGNCC 1 cut(s) 289
AsuHPI GGTGA 1 cut(s) 85
AvaII GGWCC 1 cut(s) 289
BbvI GCAGC 1 cut(s) 264
BccI CCATC 1 cut(s) 41
BclI TGATCA 2 cut(s) 109, 225
BcuI ACTAGT 1 cut(s) 206
BfaI CTAG 2 cut(s) 207, 231
BisI GCNGC 1 cut(s) 253
BlsI GCNGC 1 cut(s) 254
Bme18I GGWCC 1 cut(s) 289
BmgT120I GGNCC 1 cut(s) 289
BmsI GCATC 2 cut(s) 46, 159
BsaJI CCNNGG 2 cut(s) 188, 285
BseDI CCNNGG 2 cut(s) 188, 285
BseGI GGATG 1 cut(s) 174
BseMII CTCAG 1 cut(s) 65
BseXI GCAGC 1 cut(s) 264
Bsp143I GATC 4 cut(s) 90, 109, 151, 225
BspCNI CTCAG 1 cut(s) 66
BspHI TCATGA 1 cut(s) 43
BssECI CCNNGG 2 cut(s) 188, 285
BssMI GATC 4 cut(s) 90, 109, 151, 225
BssT1I CCWWGG 2 cut(s) 188, 285
Bst4CI ACNGT 1 cut(s) 293
BstDEI CTNAG 1 cut(s) 74
BstF5I GGATG 1 cut(s) 174
BstKTI GATC 4 cut(s) 93, 112, 154, 228
BstMBI GATC 4 cut(s) 90, 109, 151, 225
BstV1I GCAGC 1 cut(s) 264
BtsCI GGATG 1 cut(s) 174
CciI TCATGA 1 cut(s) 43
Cfr13I GGNCC 1 cut(s) 289
CviAII CATG 2 cut(s) 44, 82
CviJI RGCY 2 cut(s) 78, 255
CviKI_1 RGCY 2 cut(s) 78, 255
DdeI CTNAG 1 cut(s) 74
DpnI GATC 4 cut(s) 92, 111, 153, 227
DpnII GATC 4 cut(s) 90, 109, 151, 225
Eco130I CCWWGG 2 cut(s) 188, 285
Eco47I GGWCC 1 cut(s) 289
EcoT14I CCWWGG 2 cut(s) 188, 285
ErhI CCWWGG 2 cut(s) 188, 285
FaeI CATG 2 cut(s) 47, 85
FaiI YATR 5 cut(s) 45, 54, 83, 103, 135
FatI CATG 2 cut(s) 43, 81
FbaI TGATCA 2 cut(s) 109, 225
Fnu4HI GCNGC 1 cut(s) 253
FokI GGATG 1 cut(s) 181
Fsp4HI GCNGC 1 cut(s) 253
FspBI CTAG 2 cut(s) 207, 231
GluI GCNGC 1 cut(s) 253
Hin1II CATG 2 cut(s) 47, 85
HincII GTYRAC 1 cut(s) 141
HindII GTYRAC 1 cut(s) 141
HinfI GANTC 2 cut(s) 9, 31
HpaI GTTAAC 1 cut(s) 141
HphI GGTGA 1 cut(s) 85
Hpy166II GTNNAC 2 cut(s) 141, 238
Hpy188I TCNGA 3 cut(s) 75, 124, 267
Hpy188III TCNNGA 5 cut(s) 44, 88, 107, 155, 202
Hpy8I GTNNAC 2 cut(s) 141, 238
Hpy99I CGWCG 1 cut(s) 297
HpyAV CCTTC 1 cut(s) 152
HpyCH4III ACNGT 1 cut(s) 293
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 2 cut(s) 47, 85
Ksp22I TGATCA 2 cut(s) 109, 225
KspAI GTTAAC 1 cut(s) 141
Kzo9I GATC 4 cut(s) 90, 109, 151, 225
LpnPI CCDG 3 cut(s) 120, 158, 241
Lsp1109I GCAGC 1 cut(s) 264
LweI GCATC 2 cut(s) 46, 159
MaeI CTAG 2 cut(s) 207, 231
MalI GATC 4 cut(s) 92, 111, 153, 227
MboI GATC 4 cut(s) 90, 109, 151, 225
MboII GAAGA 1 cut(s) 161
MfeI CAATTG 1 cut(s) 15
MluCI AATT 3 cut(s) 15, 130, 218
MmeI TCCRAC 1 cut(s) 157
MnlI CCTC 1 cut(s) 89
MseI TTAA 2 cut(s) 62, 140
MslI CAYNNNNRTG 1 cut(s) 233
MspA1I CMGCKG 1 cut(s) 255
MunI CAATTG 1 cut(s) 15
NdeII GATC 4 cut(s) 90, 109, 151, 225
NlaIII CATG 2 cut(s) 47, 85
OliI CACNNNNGTG 1 cut(s) 233
PagI TCATGA 1 cut(s) 43
PfeI GAWTC 2 cut(s) 9, 31
PkrI GCNGC 1 cut(s) 254
PspPI GGNCC 1 cut(s) 289
PvuII CAGCTG 1 cut(s) 255
RseI CAYNNNNRTG 1 cut(s) 233
SaqAI TTAA 2 cut(s) 62, 140
SatI GCNGC 1 cut(s) 253
Sau3AI GATC 4 cut(s) 90, 109, 151, 225
Sau96I GGNCC 1 cut(s) 289
SetI ASST 1 cut(s) 257
SfaNI GCATC 2 cut(s) 46, 159
SinI GGWCC 1 cut(s) 289
SmiMI CAYNNNNRTG 1 cut(s) 233
SpeI ACTAGT 1 cut(s) 206
Sse9I AATT 3 cut(s) 15, 130, 218
SspMI CTAG 2 cut(s) 207, 231
StyI CCWWGG 2 cut(s) 188, 285
TaaI ACNGT 1 cut(s) 293
TasI AATT 3 cut(s) 15, 130, 218
TfiI GAWTC 2 cut(s) 9, 31
Tru1I TTAA 2 cut(s) 62, 140
Tru9I TTAA 2 cut(s) 62, 140
TseI GCWGC 1 cut(s) 252
VpaK11BI GGWCC 1 cut(s) 289
XspI CTAG 2 cut(s) 207, 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.