Rmu_sc0028414.1_g000001

Aux IAA proteins are short-lived transcriptional factors that function as repressors of early auxin response genes at low auxin concentrations

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0028414.1
Physical Location & Seq
Reverse (-)
1280 .. 1588
309 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0028414.1_g000001.1.cds

Sequence Viewer

Length: 204 bp
atggagggaatcccaattggtagaaaattgaatctgtttgctcacgatggttatgatgctttgatcacaactctgagcctcatgttcaagaccaccattctatgtcctgataataatcatgttcattcagagaaatattatgttttaacttatgaagatcaagaaggggattggatgctggttggagatgtgccttgggagtaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

67

Amino Acids

7.75

Weight (kDa)

4.58

Isoelectric Point (pI)

24.32

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 2 cut(s) 31, 88
BccI CCATC 1 cut(s) 41
BclI TGATCA 1 cut(s) 63
BmsI GCATC 2 cut(s) 46, 165
BsaBI GATNNNNATC 1 cut(s) 114
BsaJI CCNNGG 1 cut(s) 194
Bse8I GATNNNNATC 1 cut(s) 114
BseDI CCNNGG 1 cut(s) 194
BseGI GGATG 1 cut(s) 180
BseJI GATNNNNATC 1 cut(s) 114
BseMII CTCAG 1 cut(s) 65
Bsp143I GATC 2 cut(s) 63, 157
BspCNI CTCAG 1 cut(s) 66
BssECI CCNNGG 1 cut(s) 194
BssMI GATC 2 cut(s) 63, 157
BssT1I CCWWGG 1 cut(s) 194
BstDEI CTNAG 1 cut(s) 74
BstF5I GGATG 1 cut(s) 180
BstKTI GATC 2 cut(s) 66, 160
BstMBI GATC 2 cut(s) 63, 157
BtsCI GGATG 1 cut(s) 180
CviAII CATG 2 cut(s) 82, 119
CviJI RGCY 1 cut(s) 78
CviKI_1 RGCY 1 cut(s) 78
DdeI CTNAG 1 cut(s) 74
DpnI GATC 2 cut(s) 65, 159
DpnII GATC 2 cut(s) 63, 157
Eco130I CCWWGG 1 cut(s) 194
EcoT14I CCWWGG 1 cut(s) 194
ErhI CCWWGG 1 cut(s) 194
FaeI CATG 2 cut(s) 85, 122
FaiI YATR 6 cut(s) 54, 83, 103, 120, 141, 153
FatI CATG 2 cut(s) 81, 118
FbaI TGATCA 1 cut(s) 63
FokI GGATG 1 cut(s) 187
Hin1II CATG 2 cut(s) 85, 122
HinfI GANTC 2 cut(s) 9, 31
Hpy188I TCNGA 2 cut(s) 75, 130
Hpy188III TCNNGA 4 cut(s) 44, 88, 107, 161
HpyAV CCTTC 1 cut(s) 158
HpyF3I CTNAG 1 cut(s) 74
Hsp92II CATG 2 cut(s) 85, 122
Ksp22I TGATCA 1 cut(s) 63
Kzo9I GATC 2 cut(s) 63, 157
LpnPI CCDG 2 cut(s) 120, 164
LweI GCATC 2 cut(s) 46, 165
MalI GATC 2 cut(s) 65, 159
MboI GATC 2 cut(s) 63, 157
MboII GAAGA 1 cut(s) 167
MfeI CAATTG 1 cut(s) 15
MluCI AATT 2 cut(s) 15, 26
MmeI TCCRAC 1 cut(s) 163
MnlI CCTC 1 cut(s) 89
MseI TTAA 1 cut(s) 146
MunI CAATTG 1 cut(s) 15
NdeII GATC 2 cut(s) 63, 157
NlaIII CATG 2 cut(s) 85, 122
PfeI GAWTC 2 cut(s) 9, 31
SaqAI TTAA 1 cut(s) 146
Sau3AI GATC 2 cut(s) 63, 157
SfaNI GCATC 2 cut(s) 46, 165
SgeI CNNG 7 cut(s) 56, 94, 100, 119, 131, 173, 191
Sse9I AATT 2 cut(s) 15, 26
SspI AATATT 1 cut(s) 137
StyI CCWWGG 1 cut(s) 194
TasI AATT 2 cut(s) 15, 26
TfiI GAWTC 2 cut(s) 9, 31
Tru1I TTAA 1 cut(s) 146
Tru9I TTAA 1 cut(s) 146
TspDTI ATGAA 2 cut(s) 113, 168
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.