RchiOBHm_Chr5g0016621

Protein transport protein Sec24-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
11453991 .. 11455395
1405 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ29699

Sequence Viewer

Length: 213 bp
ATGATTTGCAGGTACTGGATGCCAAGTCGACCATATGCTTTTGGCTGTGTACTGCGATTGAGGACATCATCTGAATTCAAAACTGGCCATTCTTATGGTCACTTCTTTCCAGATCCACAGTATGAGAATGTTCAACACATTATCTGTTGTGATTCTTACGCCACATATGCTTATGACTTGGAGTTTGAAGCTACCAAGGAATTTGCAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling

Protein Analysis

70

Amino Acids

8.32

Weight (kDa)

6.24

Isoelectric Point (pI)

56.67

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 28
AclWI GGATC 1 cut(s) 107
AcoI YGGCCR 1 cut(s) 85
AcsI RAATTY 2 cut(s) 74, 200
AfaI GTAC 2 cut(s) 14, 51
AgsI TTSAA 3 cut(s) 79, 134, 188
AluBI AGCT 1 cut(s) 191
AluI AGCT 1 cut(s) 191
AlwI GGATC 1 cut(s) 107
AlwNI CAGNNNCTG 1 cut(s) 15
AoxI GGCC 1 cut(s) 85
ApoI RAATTY 2 cut(s) 74, 200
ArsI GACNNNNNNTTYG 2 cut(s) 167, 199
BalI TGGCCA 1 cut(s) 87
BmsI GCATC 1 cut(s) 9
BsaJI CCNNGG 1 cut(s) 195
Bse1I ACTGG 2 cut(s) 20, 88
BseDI CCNNGG 1 cut(s) 195
BseGI GGATG 1 cut(s) 24
BseNI ACTGG 2 cut(s) 20, 88
BshFI GGCC 1 cut(s) 87
BsnI GGCC 1 cut(s) 87
Bsp143I GATC 1 cut(s) 112
BspANI GGCC 1 cut(s) 87
BspPI GGATC 1 cut(s) 107
BsrI ACTGG 2 cut(s) 20, 88
BssECI CCNNGG 1 cut(s) 195
BssMI GATC 1 cut(s) 112
BssT1I CCWWGG 1 cut(s) 195
Bst4CI ACNGT 1 cut(s) 120
BstF5I GGATG 1 cut(s) 24
BstKTI GATC 1 cut(s) 115
BstMBI GATC 1 cut(s) 112
BstMWI GCNNNNNNNGC 1 cut(s) 167
BstX2I RGATCY 1 cut(s) 112
BstXI CCANNNNNNTGG 1 cut(s) 95
BstYI RGATCY 1 cut(s) 112
BsuRI GGCC 1 cut(s) 87
BtsCI GGATG 1 cut(s) 24
CaiI CAGNNNCTG 1 cut(s) 15
Csp6I GTAC 2 cut(s) 13, 50
CviJI RGCY 3 cut(s) 45, 87, 191
CviKI_1 RGCY 3 cut(s) 45, 87, 191
CviQI GTAC 2 cut(s) 13, 50
DpnI GATC 1 cut(s) 114
DpnII GATC 1 cut(s) 112
EaeI YGGCCR 1 cut(s) 85
Eco130I CCWWGG 1 cut(s) 195
EcoRI GAATTC 1 cut(s) 74
EcoT14I CCWWGG 1 cut(s) 195
ErhI CCWWGG 1 cut(s) 195
FaiI YATR 7 cut(s) 34, 36, 96, 123, 166, 168, 174
FauNDI CATATG 2 cut(s) 34, 166
FblI GTMKAC 1 cut(s) 28
FokI GGATG 1 cut(s) 31
HaeIII GGCC 1 cut(s) 87
HincII GTYRAC 1 cut(s) 29
HindII GTYRAC 1 cut(s) 29
HinfI GANTC 1 cut(s) 152
Hpy166II GTNNAC 2 cut(s) 29, 50
Hpy188I TCNGA 1 cut(s) 73
Hpy188III TCNNGA 1 cut(s) 110
Hpy8I GTNNAC 2 cut(s) 29, 50
HpyCH4III ACNGT 1 cut(s) 120
HpyCH4V TGCA 2 cut(s) 9, 206
HpyF10VI GCNNNNNNNGC 1 cut(s) 167
Kzo9I GATC 1 cut(s) 112
LpnPI CCDG 2 cut(s) 69, 123
LweI GCATC 1 cut(s) 9
MaeIII GTNAC 1 cut(s) 98
MalI GATC 1 cut(s) 114
MboI GATC 1 cut(s) 112
MflI RGATCY 1 cut(s) 112
MlsI TGGCCA 1 cut(s) 87
MluCI AATT 2 cut(s) 74, 200
MluNI TGGCCA 1 cut(s) 87
MnlI CCTC 1 cut(s) 54
Mox20I TGGCCA 1 cut(s) 87
MscI TGGCCA 1 cut(s) 87
MslI CAYNNNNRTG 1 cut(s) 93
Msp20I TGGCCA 1 cut(s) 87
MwoI GCNNNNNNNGC 1 cut(s) 167
NdeI CATATG 2 cut(s) 34, 166
NdeII GATC 1 cut(s) 112
NmuCI GTSAC 1 cut(s) 98
PfeI GAWTC 1 cut(s) 152
PstNI CAGNNNCTG 1 cut(s) 15
PsuI RGATCY 1 cut(s) 112
RsaI GTAC 2 cut(s) 14, 51
RsaNI GTAC 2 cut(s) 13, 50
RseI CAYNNNNRTG 1 cut(s) 93
SalI GTCGAC 1 cut(s) 27
Sau3AI GATC 1 cut(s) 112
SetI ASST 2 cut(s) 14, 193
SfaNI GCATC 1 cut(s) 9
SgeI CNNG 7 cut(s) 22, 28, 36, 96, 122, 190, 208
SmiMI CAYNNNNRTG 1 cut(s) 93
Sse9I AATT 2 cut(s) 74, 200
StyI CCWWGG 1 cut(s) 195
TaaI ACNGT 1 cut(s) 120
TaqI TCGA 1 cut(s) 28
TasI AATT 2 cut(s) 74, 200
TatI WGTACW 1 cut(s) 49
TfiI GAWTC 1 cut(s) 152
TseFI GTSAC 1 cut(s) 98
Tsp45I GTSAC 1 cut(s) 98
XapI RAATTY 2 cut(s) 74, 200
XmiI GTMKAC 1 cut(s) 28
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.