RchiOBHm_Chr5g0044481

Protein transport protein Sec24-like

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
39811653 .. 39813881
2229 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ32269

Sequence Viewer

Length: 195 bp
ATGCTAAGTCGACCATATGCTTTTGGCTGTGTACTGCGATTGAGGACATCATCTGAATTCAAAACTGGTCATTCTTATGGTCACTTCTTTCCAGATCCACAGTATGAGAATGTTCAACACATTATCTGTTGTGATTCTTACGCCACATATGCTTATGACTTTGAGTTTGAAGCTACCAAGGAATTTTCAAAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling

Protein Analysis

64

Amino Acids

7.53

Weight (kDa)

5.81

Isoelectric Point (pI)

49.09

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 10
AclWI GGATC 1 cut(s) 89
AcsI RAATTY 2 cut(s) 56, 182
AfaI GTAC 1 cut(s) 33
AgsI TTSAA 4 cut(s) 61, 116, 170, 189
AluBI AGCT 1 cut(s) 173
AluI AGCT 1 cut(s) 173
AlwI GGATC 1 cut(s) 89
ApoI RAATTY 2 cut(s) 56, 182
ArsI GACNNNNNNTTYG 2 cut(s) 149, 181
BsaJI CCNNGG 1 cut(s) 177
Bse1I ACTGG 1 cut(s) 70
BseDI CCNNGG 1 cut(s) 177
BseNI ACTGG 1 cut(s) 70
Bsp143I GATC 1 cut(s) 94
BspPI GGATC 1 cut(s) 89
BsrI ACTGG 1 cut(s) 70
BssECI CCNNGG 1 cut(s) 177
BssMI GATC 1 cut(s) 94
BssT1I CCWWGG 1 cut(s) 177
Bst4CI ACNGT 1 cut(s) 102
BstDEI CTNAG 1 cut(s) 5
BstKTI GATC 1 cut(s) 97
BstMBI GATC 1 cut(s) 94
BstMWI GCNNNNNNNGC 1 cut(s) 149
BstX2I RGATCY 1 cut(s) 94
BstYI RGATCY 1 cut(s) 94
Csp6I GTAC 1 cut(s) 32
CviJI RGCY 2 cut(s) 27, 173
CviKI_1 RGCY 2 cut(s) 27, 173
CviQI GTAC 1 cut(s) 32
DdeI CTNAG 1 cut(s) 5
DpnI GATC 1 cut(s) 96
DpnII GATC 1 cut(s) 94
Eco130I CCWWGG 1 cut(s) 177
EcoRI GAATTC 1 cut(s) 56
EcoT14I CCWWGG 1 cut(s) 177
ErhI CCWWGG 1 cut(s) 177
FaiI YATR 7 cut(s) 16, 18, 78, 105, 148, 150, 156
FauNDI CATATG 2 cut(s) 16, 148
FblI GTMKAC 1 cut(s) 10
HincII GTYRAC 1 cut(s) 11
HindII GTYRAC 1 cut(s) 11
HinfI GANTC 1 cut(s) 134
Hpy166II GTNNAC 2 cut(s) 11, 32
Hpy188I TCNGA 1 cut(s) 55
Hpy188III TCNNGA 1 cut(s) 92
Hpy8I GTNNAC 2 cut(s) 11, 32
HpyCH4III ACNGT 1 cut(s) 102
HpyF10VI GCNNNNNNNGC 1 cut(s) 149
HpyF3I CTNAG 1 cut(s) 5
Kzo9I GATC 1 cut(s) 94
LpnPI CCDG 2 cut(s) 51, 105
MaeIII GTNAC 1 cut(s) 80
MalI GATC 1 cut(s) 96
MboI GATC 1 cut(s) 94
MflI RGATCY 1 cut(s) 94
MluCI AATT 2 cut(s) 56, 182
MnlI CCTC 1 cut(s) 36
MslI CAYNNNNRTG 1 cut(s) 75
MwoI GCNNNNNNNGC 1 cut(s) 149
NdeI CATATG 2 cut(s) 16, 148
NdeII GATC 1 cut(s) 94
NmuCI GTSAC 1 cut(s) 80
PfeI GAWTC 1 cut(s) 134
PsuI RGATCY 1 cut(s) 94
RsaI GTAC 1 cut(s) 33
RsaNI GTAC 1 cut(s) 32
RseI CAYNNNNRTG 1 cut(s) 75
SalI GTCGAC 1 cut(s) 9
Sau3AI GATC 1 cut(s) 94
SetI ASST 1 cut(s) 175
SgeI CNNG 3 cut(s) 78, 104, 190
SmiMI CAYNNNNRTG 1 cut(s) 75
Sse9I AATT 2 cut(s) 56, 182
StyI CCWWGG 1 cut(s) 177
TaaI ACNGT 1 cut(s) 102
TaqI TCGA 1 cut(s) 10
TasI AATT 2 cut(s) 56, 182
TatI WGTACW 1 cut(s) 31
TfiI GAWTC 1 cut(s) 134
TseFI GTSAC 1 cut(s) 80
Tsp45I GTSAC 1 cut(s) 80
XapI RAATTY 2 cut(s) 56, 182
XmiI GTMKAC 1 cut(s) 10
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.