RchiOBHm_Chr5g0068631

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
5
Physical Location & Seq
Reverse (-)
74581020 .. 74584594
3575 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ34407

Sequence Viewer

Length: 156 bp
ATGATGACTTATGATAAGGCTTCAAAATTCGGGGTACCCAAATGGATCTACCCGATTCAGTGTGAAAAAAGAGGGAGGCAGCATATACGCAGCACCATATTGATGCAGTCAGAACAGAGTGGGCAAAATTTGTTGTTAAAACATATATGTAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

6.02

Weight (kDa)

9.83

Isoelectric Point (pI)

76.14

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 34
AccB1I GGYRCC 1 cut(s) 34
AclWI GGATC 1 cut(s) 53
AcsI RAATTY 2 cut(s) 26, 127
AfaI GTAC 1 cut(s) 36
AgsI TTSAA 1 cut(s) 24
AlwI GGATC 1 cut(s) 53
ApeKI GCWGC 2 cut(s) 79, 90
ApoI RAATTY 2 cut(s) 26, 127
Asp718I GGTACC 1 cut(s) 34
BanI GGYRCC 1 cut(s) 34
BbvI GCAGC 2 cut(s) 91, 102
BisI GCNGC 2 cut(s) 80, 91
BlsI GCNGC 2 cut(s) 81, 92
BmiI GGNNCC 1 cut(s) 36
BmsI GCATC 1 cut(s) 93
BseXI GCAGC 2 cut(s) 91, 102
BshNI GGYRCC 1 cut(s) 34
Bsp143I GATC 1 cut(s) 45
BspLI GGNNCC 1 cut(s) 36
BspPI GGATC 1 cut(s) 53
BspT107I GGYRCC 1 cut(s) 34
BssMI GATC 1 cut(s) 45
BstKTI GATC 1 cut(s) 48
BstMBI GATC 1 cut(s) 45
BstV1I GCAGC 2 cut(s) 91, 102
BstX2I RGATCY 1 cut(s) 45
BstYI RGATCY 1 cut(s) 45
BtsIMutI CAGTG 1 cut(s) 65
Csp6I GTAC 1 cut(s) 35
CviJI RGCY 1 cut(s) 20
CviKI_1 RGCY 1 cut(s) 20
CviQI GTAC 1 cut(s) 35
DpnI GATC 1 cut(s) 47
DpnII GATC 1 cut(s) 45
FaiI YATR 7 cut(s) 12, 84, 86, 98, 144, 146, 148
Fnu4HI GCNGC 2 cut(s) 80, 91
Fsp4HI GCNGC 2 cut(s) 80, 91
GluI GCNGC 2 cut(s) 80, 91
HinfI GANTC 1 cut(s) 55
Hpy188I TCNGA 1 cut(s) 112
HpyCH4V TGCA 1 cut(s) 106
KpnI GGTACC 1 cut(s) 38
Kzo9I GATC 1 cut(s) 45
Lsp1109I GCAGC 2 cut(s) 91, 102
LweI GCATC 1 cut(s) 93
MalI GATC 1 cut(s) 47
MboI GATC 1 cut(s) 45
MflI RGATCY 1 cut(s) 45
MluCI AATT 2 cut(s) 26, 127
MnlI CCTC 2 cut(s) 65, 69
MseI TTAA 1 cut(s) 137
MslI CAYNNNNRTG 1 cut(s) 101
NdeII GATC 1 cut(s) 45
NlaIV GGNNCC 1 cut(s) 36
PfeI GAWTC 1 cut(s) 55
PkrI GCNGC 2 cut(s) 81, 92
PspN4I GGNNCC 1 cut(s) 36
PsuI RGATCY 1 cut(s) 45
RsaI GTAC 1 cut(s) 36
RsaNI GTAC 1 cut(s) 35
RseI CAYNNNNRTG 1 cut(s) 101
SaqAI TTAA 1 cut(s) 137
SatI GCNGC 2 cut(s) 80, 91
Sau3AI GATC 1 cut(s) 45
SfaNI GCATC 1 cut(s) 93
SgeI CNNG 2 cut(s) 43, 64
SmiMI CAYNNNNRTG 1 cut(s) 101
Sse9I AATT 2 cut(s) 26, 127
TasI AATT 2 cut(s) 26, 127
TfiI GAWTC 1 cut(s) 55
Tru1I TTAA 1 cut(s) 137
Tru9I TTAA 1 cut(s) 137
TscAI CASTG 1 cut(s) 65
TseI GCWGC 2 cut(s) 79, 90
TspRI CASTG 1 cut(s) 65
XapI RAATTY 2 cut(s) 26, 127
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.