RchiOBHm_Chr6g0288721

No description available

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
51874151 .. 51875021
871 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ25903

Sequence Viewer

Length: 267 bp
ATGAACTGCATTGTAGGACATCTGGTTTTGACAATTCAAAACCACCAGATTTTCCACAGGGCAGTCACTAGCATGGCCTCAGTGCAGTCTGAAGTTAGGCAGTGCAGAGCTACCGTGTTGAACATTAACTCTGTAATACCCGGTATATTCTCTGTAGAGGGTGTCCCTGTATATTGGCGGATTGAACTCAGATGGAAGCTCCTTTATAGGTCCATATGGCTTGACATGTTTGTCACTATCCACGGGAACGAAGAAAGACGCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

88

Amino Acids

10.29

Weight (kDa)

9.38

Isoelectric Point (pI)

49.73

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 230
AciI CCGC 1 cut(s) 178
AcuI CTGAAG 1 cut(s) 111
AflIII ACRYGT 1 cut(s) 225
AgsI TTSAA 3 cut(s) 38, 121, 185
AluBI AGCT 2 cut(s) 110, 199
AluI AGCT 2 cut(s) 110, 199
AoxI GGCC 1 cut(s) 75
AspS9I GGNCC 1 cut(s) 210
AsuC2I CCSGG 1 cut(s) 141
AvaII GGWCC 1 cut(s) 210
BccI CCATC 1 cut(s) 186
BcnI CCSGG 1 cut(s) 141
BfaI CTAG 1 cut(s) 69
BfmI CTRYAG 1 cut(s) 153
Bme1390I CCNGG 1 cut(s) 141
Bme18I GGWCC 1 cut(s) 210
BmgT120I GGNCC 1 cut(s) 210
BmrFI CCNGG 1 cut(s) 141
BpuMI CCSGG 1 cut(s) 141
BsaJI CCNNGG 1 cut(s) 241
BseDI CCNNGG 1 cut(s) 241
BseMII CTCAG 2 cut(s) 93, 202
BsgI GTGCAG 2 cut(s) 104, 124
BshFI GGCC 1 cut(s) 77
BsiSI CCGG 1 cut(s) 141
BslFI GGGAC 1 cut(s) 149
BsmFI GGGAC 1 cut(s) 149
BsnI GGCC 1 cut(s) 77
BspACI CCGC 1 cut(s) 178
BspANI GGCC 1 cut(s) 77
BspCNI CTCAG 2 cut(s) 92, 201
BssECI CCNNGG 1 cut(s) 241
Bst4CI ACNGT 1 cut(s) 115
BstDEI CTNAG 2 cut(s) 79, 188
BstDSI CCRYGG 1 cut(s) 241
BstNSI RCATGY 1 cut(s) 229
BstSCI CCNGG 1 cut(s) 139
BstSFI CTRYAG 1 cut(s) 153
BsuRI GGCC 1 cut(s) 77
BtgI CCRYGG 1 cut(s) 241
BtsI GCAGTG 1 cut(s) 107
BtsIMutI CAGTG 2 cut(s) 87, 107
Cfr13I GGNCC 1 cut(s) 210
CviAII CATG 2 cut(s) 73, 226
CviJI RGCY 4 cut(s) 77, 110, 199, 220
CviKI_1 RGCY 4 cut(s) 77, 110, 199, 220
DdeI CTNAG 2 cut(s) 79, 188
DrdI GACNNNNNNGTC 1 cut(s) 230
DseDI GACNNNNNNGTC 1 cut(s) 230
EciI GGCGGA 1 cut(s) 193
Eco47I GGWCC 1 cut(s) 210
Eco57I CTGAAG 1 cut(s) 111
FaeI CATG 2 cut(s) 76, 229
FaiI YATR 7 cut(s) 74, 146, 172, 207, 215, 217, 227
FaqI GGGAC 1 cut(s) 149
FatI CATG 2 cut(s) 72, 225
FauNDI CATATG 1 cut(s) 215
FspBI CTAG 1 cut(s) 69
HaeIII GGCC 1 cut(s) 77
HapII CCGG 1 cut(s) 141
Hin1II CATG 2 cut(s) 76, 229
HpaII CCGG 1 cut(s) 141
Hpy188I TCNGA 2 cut(s) 91, 191
HpyCH4III ACNGT 1 cut(s) 115
HpyCH4V TGCA 3 cut(s) 9, 85, 105
HpyF3I CTNAG 2 cut(s) 79, 188
Hsp92II CATG 2 cut(s) 76, 229
LmnI GCTCC 1 cut(s) 204
LpnPI CCDG 5 cut(s) 8, 43, 59, 154, 180
MaeI CTAG 1 cut(s) 69
MaeIII GTNAC 2 cut(s) 64, 232
MboII GAAGA 1 cut(s) 263
MluCI AATT 1 cut(s) 33
MnlI CCTC 2 cut(s) 88, 151
MseI TTAA 1 cut(s) 126
MslI CAYNNNNRTG 1 cut(s) 71
MspI CCGG 1 cut(s) 141
MspR9I CCNGG 1 cut(s) 141
NciI CCSGG 1 cut(s) 141
NdeI CATATG 1 cut(s) 215
NlaIII CATG 2 cut(s) 76, 229
NmuCI GTSAC 2 cut(s) 64, 232
NspI RCATGY 1 cut(s) 229
PciI ACATGT 1 cut(s) 225
PscI ACATGT 1 cut(s) 225
PspPI GGNCC 1 cut(s) 210
RseI CAYNNNNRTG 1 cut(s) 71
SaqAI TTAA 1 cut(s) 126
Sau96I GGNCC 1 cut(s) 210
ScrFI CCNGG 1 cut(s) 141
SetI ASST 3 cut(s) 112, 201, 212
SfcI CTRYAG 1 cut(s) 153
SinI GGWCC 1 cut(s) 210
SmiMI CAYNNNNRTG 1 cut(s) 71
Sse9I AATT 1 cut(s) 33
SsiI CCGC 1 cut(s) 178
SspMI CTAG 1 cut(s) 69
StyD4I CCNGG 1 cut(s) 139
TaaI ACNGT 1 cut(s) 115
TasI AATT 1 cut(s) 33
Tru1I TTAA 1 cut(s) 126
Tru9I TTAA 1 cut(s) 126
TscAI CASTG 2 cut(s) 87, 107
TseFI GTSAC 2 cut(s) 64, 232
Tsp45I GTSAC 2 cut(s) 64, 232
TspDTI ATGAA 1 cut(s) 17
TspRI CASTG 2 cut(s) 87, 107
VpaK11BI GGWCC 1 cut(s) 210
XceI RCATGY 1 cut(s) 229
XspI CTAG 1 cut(s) 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.