Rh6CG322200

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
OG0007075
Physical Location & Seq
Reverse (-)
50839265 .. 50840143
879 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG322200.1

Sequence Viewer

Length: 381 bp
ATGCCTTGGGGTAGTGGCCACAGCTCGTATTCATTTAGTAATTCTACACCTTCTTCATTCTTGGACCTCACCTTACTAGACTACATGCTAATCCATGCTTCGGGGATTGGATTGCATGGCTCCAATATAGGACATCTGGTTTTGACAATTCAAAACCACCAGATTTTCCACAGGGCAGTCACTAGCATGGCCTCAGTGCAGTCTGAAGTTAGGCAGTGCAGAGCTACCGTGTTGAACATTAACTCTGTAATACCCGGTATATTCTCTGTAGAGGGTGTCCCTGTATATTGGCGGATTGAACTCAGATGGAAGCTCCTTTATAGGTCCATATGGCTTGACATGTTTGTCACTATCCACGGGAACGAAGAAAGACGCAACTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

126

Amino Acids

14.31

Weight (kDa)

8.03

Isoelectric Point (pI)

52.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 344
AciI CCGC 1 cut(s) 292
AcoI YGGCCR 1 cut(s) 16
AcuI CTGAAG 1 cut(s) 225
AfiI CCNNNNNNNGG 1 cut(s) 100
AflIII ACRYGT 1 cut(s) 339
AgsI TTSAA 3 cut(s) 152, 235, 299
AluBI AGCT 3 cut(s) 24, 224, 313
AluI AGCT 3 cut(s) 24, 224, 313
AoxI GGCC 2 cut(s) 16, 189
AspS9I GGNCC 2 cut(s) 64, 324
AsuC2I CCSGG 1 cut(s) 255
AsuHPI GGTGA 1 cut(s) 61
AvaII GGWCC 2 cut(s) 64, 324
BalI TGGCCA 1 cut(s) 18
BccI CCATC 1 cut(s) 300
BcnI CCSGG 1 cut(s) 255
BfaI CTAG 2 cut(s) 77, 183
BfmI CTRYAG 1 cut(s) 267
Bme1390I CCNGG 1 cut(s) 255
Bme18I GGWCC 2 cut(s) 64, 324
BmgT120I GGNCC 2 cut(s) 64, 324
BmiI GGNNCC 1 cut(s) 121
BmrFI CCNGG 1 cut(s) 255
BpuMI CCSGG 1 cut(s) 255
BsaJI CCNNGG 2 cut(s) 5, 355
Bsc4I CCNNNNNNNGG 1 cut(s) 100
BseDI CCNNGG 2 cut(s) 5, 355
BseLI CCNNNNNNNGG 1 cut(s) 100
BseMII CTCAG 2 cut(s) 207, 316
BsgI GTGCAG 2 cut(s) 218, 238
BshFI GGCC 2 cut(s) 18, 191
BsiSI CCGG 1 cut(s) 255
BslFI GGGAC 1 cut(s) 263
BslI CCNNNNNNNGG 1 cut(s) 100
BsmFI GGGAC 1 cut(s) 263
BsnI GGCC 2 cut(s) 18, 191
BspACI CCGC 1 cut(s) 292
BspANI GGCC 2 cut(s) 18, 191
BspCNI CTCAG 2 cut(s) 206, 315
BspLI GGNNCC 1 cut(s) 121
BssECI CCNNGG 2 cut(s) 5, 355
BssT1I CCWWGG 1 cut(s) 5
Bst4CI ACNGT 1 cut(s) 229
BstDEI CTNAG 2 cut(s) 193, 302
BstDSI CCRYGG 1 cut(s) 355
BstNSI RCATGY 2 cut(s) 88, 343
BstSCI CCNGG 1 cut(s) 253
BstSFI CTRYAG 1 cut(s) 267
BsuRI GGCC 2 cut(s) 18, 191
BtgI CCRYGG 1 cut(s) 355
BtsI GCAGTG 1 cut(s) 221
BtsIMutI CAGTG 2 cut(s) 201, 221
Cfr13I GGNCC 2 cut(s) 64, 324
CviAII CATG 5 cut(s) 85, 95, 116, 187, 340
CviJI RGCY 7 cut(s) 18, 24, 120, 191, 224, 313, 334
CviKI_1 RGCY 7 cut(s) 18, 24, 120, 191, 224, 313, 334
DdeI CTNAG 2 cut(s) 193, 302
DrdI GACNNNNNNGTC 1 cut(s) 344
DseDI GACNNNNNNGTC 1 cut(s) 344
EaeI YGGCCR 1 cut(s) 16
EciI GGCGGA 1 cut(s) 307
Eco130I CCWWGG 1 cut(s) 5
Eco47I GGWCC 2 cut(s) 64, 324
Eco57I CTGAAG 1 cut(s) 225
EcoT14I CCWWGG 1 cut(s) 5
ErhI CCWWGG 1 cut(s) 5
FaeI CATG 5 cut(s) 88, 98, 119, 190, 343
FaqI GGGAC 1 cut(s) 263
FatI CATG 5 cut(s) 84, 94, 115, 186, 339
FauNDI CATATG 1 cut(s) 329
FspBI CTAG 2 cut(s) 77, 183
HaeIII GGCC 2 cut(s) 18, 191
HapII CCGG 1 cut(s) 255
Hin1II CATG 5 cut(s) 88, 98, 119, 190, 343
HpaII CCGG 1 cut(s) 255
HphI GGTGA 1 cut(s) 61
Hpy188I TCNGA 2 cut(s) 205, 305
HpyAV CCTTC 1 cut(s) 60
HpyCH4III ACNGT 1 cut(s) 229
HpyCH4V TGCA 3 cut(s) 115, 199, 219
HpyF3I CTNAG 2 cut(s) 193, 302
Hsp92II CATG 5 cut(s) 88, 98, 119, 190, 343
LmnI GCTCC 2 cut(s) 125, 318
LpnPI CCDG 5 cut(s) 122, 157, 173, 268, 294
MaeI CTAG 2 cut(s) 77, 183
MaeIII GTNAC 2 cut(s) 178, 346
MboII GAAGA 2 cut(s) 45, 377
MlsI TGGCCA 1 cut(s) 18
MluCI AATT 2 cut(s) 40, 147
MluNI TGGCCA 1 cut(s) 18
MnlI CCTC 3 cut(s) 77, 202, 265
Mox20I TGGCCA 1 cut(s) 18
MscI TGGCCA 1 cut(s) 18
MseI TTAA 1 cut(s) 240
MslI CAYNNNNRTG 1 cut(s) 185
Msp20I TGGCCA 1 cut(s) 18
MspI CCGG 1 cut(s) 255
MspR9I CCNGG 1 cut(s) 255
NciI CCSGG 1 cut(s) 255
NdeI CATATG 1 cut(s) 329
NlaIII CATG 5 cut(s) 88, 98, 119, 190, 343
NlaIV GGNNCC 1 cut(s) 121
NmuCI GTSAC 2 cut(s) 178, 346
NspI RCATGY 2 cut(s) 88, 343
PciI ACATGT 1 cut(s) 339
PscI ACATGT 1 cut(s) 339
PspN4I GGNNCC 1 cut(s) 121
PspPI GGNCC 2 cut(s) 64, 324
RseI CAYNNNNRTG 1 cut(s) 185
SaqAI TTAA 1 cut(s) 240
Sau96I GGNCC 2 cut(s) 64, 324
ScrFI CCNGG 1 cut(s) 255
SetI ASST 7 cut(s) 26, 52, 69, 74, 226, 315, 326
SfcI CTRYAG 1 cut(s) 267
SinI GGWCC 2 cut(s) 64, 324
SmiMI CAYNNNNRTG 1 cut(s) 185
Sse9I AATT 2 cut(s) 40, 147
SsiI CCGC 1 cut(s) 292
SspMI CTAG 2 cut(s) 77, 183
StyD4I CCNGG 1 cut(s) 253
StyI CCWWGG 1 cut(s) 5
TaaI ACNGT 1 cut(s) 229
TasI AATT 2 cut(s) 40, 147
Tru1I TTAA 1 cut(s) 240
Tru9I TTAA 1 cut(s) 240
TscAI CASTG 2 cut(s) 201, 221
TseFI GTSAC 2 cut(s) 178, 346
Tsp45I GTSAC 2 cut(s) 178, 346
TspDTI ATGAA 2 cut(s) 21, 45
TspRI CASTG 2 cut(s) 201, 221
VpaK11BI GGWCC 2 cut(s) 64, 324
XceI RCATGY 2 cut(s) 88, 343
XspI CTAG 2 cut(s) 77, 183
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.