RchiOBHm_Chr6g0307621

EF hand

Basic Information

Type: gene
Biological Identity
rosa_chinensis
6
Physical Location & Seq
Reverse (-)
65904471 .. 65905013
543 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ27657

Sequence Viewer

Length: 366 bp
ATGATCCAAGGCTTTTACAGCACAAACTTGCTAATACAAGTATCCGACTACTACAAGCTAAATTATATACTTCTCTCAATGGCGATTAAGAGCAAGTGTGTCGCTAGTGATGGCAAACGTGTTATGACCACCGAGGAGTTGAAGAAATGGCTGAAGAAATTTGATACTGACAAAGATGGCCGTATAAGCAAAGAGGAACTCCGCCAGGCTATCCGCTCCACCGGCGGACGCTTTGCCACGTTCAAGAGCAGGCGTGGGTTACGATCTGCAGATGTCAATCAAGACGGATACATAGGTGAAGAAGAACTCGACAACCTTGTAGAGTTTGCACAGAAGTATTTGGGTGTCAGGATCATACACTTTTGA

Protein Analysis

121

Amino Acids

14.0

Weight (kDa)

9.35

Isoelectric Point (pI)

42.03

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 37 - 71 1.6e-07 EF-hand domain pair
EF-hand_1 PF00036 46 - 73 6.1e-08 EF hand domain
EF-hand_6 PF13405 46 - 75 5e-08 EF-hand domain
EF-hand_5 PF13202 47 - 69 1.6e-08 EF hand
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 216
AciI CCGC 3 cut(s) 202, 214, 225
AclWI GGATC 1 cut(s) 359
AcoI YGGCCR 1 cut(s) 178
AcsI RAATTY 1 cut(s) 158
AcuI CTGAAG 1 cut(s) 173
AflIII ACRYGT 1 cut(s) 118
AgsI TTSAA 2 cut(s) 142, 244
AjnI CCWGG 1 cut(s) 204
AluBI AGCT 1 cut(s) 58
AluI AGCT 1 cut(s) 58
AlwI GGATC 1 cut(s) 359
AoxI GGCC 1 cut(s) 178
ApoI RAATTY 1 cut(s) 158
AsuHPI GGTGA 1 cut(s) 308
BaeI ACNNNNGTAYC 2 cut(s) 280, 313
BccI CCATC 2 cut(s) 104, 170
BceAI ACGGC 1 cut(s) 165
BcgI CGANNNNNNTGC 2 cut(s) 82, 116
BciT130I CCWGG 1 cut(s) 206
BciVI GTATCC 2 cut(s) 52, 281
BfaI CTAG 1 cut(s) 105
BfmI CTRYAG 1 cut(s) 267
BfuI GTATCC 2 cut(s) 52, 281
Bme1390I CCNGG 1 cut(s) 206
BmrFI CCNGG 1 cut(s) 206
BsaBI GATNNNNATC 1 cut(s) 276
BsaJI CCNNGG 2 cut(s) 7, 132
Bse118I RCCGGY 1 cut(s) 221
Bse8I GATNNNNATC 1 cut(s) 276
BseBI CCWGG 1 cut(s) 206
BseDI CCNNGG 2 cut(s) 7, 132
BseJI GATNNNNATC 1 cut(s) 276
BseRI GAGGAG 1 cut(s) 149
BshFI GGCC 1 cut(s) 180
BsiSI CCGG 1 cut(s) 222
BsnI GGCC 1 cut(s) 180
Bsp143I GATC 3 cut(s) 3, 263, 351
BspACI CCGC 3 cut(s) 202, 214, 225
BspANI GGCC 1 cut(s) 180
BspMAI CTGCAG 1 cut(s) 271
BspPI GGATC 1 cut(s) 359
BsrBI CCGCTC 1 cut(s) 216
BsrFI RCCGGY 1 cut(s) 221
BssAI RCCGGY 1 cut(s) 221
BssECI CCNNGG 2 cut(s) 7, 132
BssMI GATC 3 cut(s) 3, 263, 351
BssT1I CCWWGG 1 cut(s) 7
Bst2UI CCWGG 1 cut(s) 206
BstC8I GCNNGC 1 cut(s) 251
BstKTI GATC 3 cut(s) 6, 266, 354
BstMBI GATC 3 cut(s) 3, 263, 351
BstMWI GCNNNNNNNGC 3 cut(s) 18, 186, 222
BstNI CCWGG 1 cut(s) 206
BstSCI CCNGG 1 cut(s) 204
BstSFI CTRYAG 1 cut(s) 267
BsuI GTATCC 2 cut(s) 52, 281
BsuRI GGCC 1 cut(s) 180
Cac8I GCNNGC 1 cut(s) 251
Cfr10I RCCGGY 1 cut(s) 221
CseI GACGC 1 cut(s) 237
CviJI RGCY 5 cut(s) 12, 58, 151, 180, 209
CviKI_1 RGCY 5 cut(s) 12, 58, 151, 180, 209
DpnI GATC 3 cut(s) 5, 265, 353
DpnII GATC 3 cut(s) 3, 263, 351
EaeI YGGCCR 1 cut(s) 178
EciI GGCGGA 2 cut(s) 191, 240
Eco130I CCWWGG 1 cut(s) 7
Eco57I CTGAAG 1 cut(s) 173
EcoRII CCWGG 1 cut(s) 204
EcoT14I CCWWGG 1 cut(s) 7
ErhI CCWWGG 1 cut(s) 7
FaiI YATR 6 cut(s) 66, 68, 125, 185, 293, 356
FspBI CTAG 1 cut(s) 105
HaeIII GGCC 1 cut(s) 180
HapII CCGG 1 cut(s) 222
HgaI GACGC 1 cut(s) 237
HpaII CCGG 1 cut(s) 222
HphI GGTGA 1 cut(s) 308
Hpy188I TCNGA 1 cut(s) 46
Hpy188III TCNNGA 3 cut(s) 244, 281, 349
HpyCH4IV ACGT 2 cut(s) 118, 239
HpyCH4V TGCA 2 cut(s) 269, 329
HpyF10VI GCNNNNNNNGC 3 cut(s) 18, 186, 222
HpySE526I ACGT 2 cut(s) 118, 239
Kzo9I GATC 3 cut(s) 3, 263, 351
LmnI GCTCC 1 cut(s) 221
LpnPI CCDG 5 cut(s) 191, 218, 235, 235, 334
MaeI CTAG 1 cut(s) 105
MaeII ACGT 2 cut(s) 118, 239
MaeIII GTNAC 1 cut(s) 258
MalI GATC 3 cut(s) 5, 265, 353
MbiI CCGCTC 1 cut(s) 216
MboI GATC 3 cut(s) 3, 263, 351
MboII GAAGA 4 cut(s) 154, 166, 311, 314
MluCI AATT 2 cut(s) 61, 158
MmeI TCCRAC 1 cut(s) 69
MnlI CCTC 2 cut(s) 127, 187
MseI TTAA 1 cut(s) 87
MspI CCGG 1 cut(s) 222
MspR9I CCNGG 1 cut(s) 206
MvaI CCWGG 1 cut(s) 206
MwoI GCNNNNNNNGC 3 cut(s) 18, 186, 222
NdeII GATC 3 cut(s) 3, 263, 351
Psp6I CCWGG 1 cut(s) 204
PspGI CCWGG 1 cut(s) 204
PstI CTGCAG 1 cut(s) 271
SaqAI TTAA 1 cut(s) 87
Sau3AI GATC 3 cut(s) 3, 263, 351
ScrFI CCNGG 1 cut(s) 206
SetI ASST 5 cut(s) 60, 121, 242, 298, 318
SfcI CTRYAG 1 cut(s) 267
SgrAI CRCCGGYG 1 cut(s) 221
Sse9I AATT 2 cut(s) 61, 158
SsiI CCGC 3 cut(s) 202, 214, 225
SspMI CTAG 1 cut(s) 105
StyD4I CCNGG 1 cut(s) 204
StyI CCWWGG 1 cut(s) 7
TaiI ACGT 2 cut(s) 121, 242
TaqI TCGA 1 cut(s) 309
TasI AATT 2 cut(s) 61, 158
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TspGWI ACGGA 1 cut(s) 300
XapI RAATTY 1 cut(s) 158
XspI CTAG 1 cut(s) 105
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.