Rw5G029970

EF hand

Basic Information

Type: gene
Biological Identity
rosa_wichuraiana
Chr5
Physical Location & Seq
Reverse (-)
46912480 .. 46912767
288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rw5G029970.1

Sequence Viewer

Length: 288 bp
ATGGCGATTAAGAGCAGGTCTATCGCTAGTGATGGCGAACGTGTTATGACCACCGAGGAGTTGAAGAAATGGCTGAAGAAATTTGATACTGACAAAGATGACCGTATAAGCAAAGAGGAACTCCGCCAGGCTATCCGCTCCACTGGCGAAAGCTTTGCCACGTTCAAGAGCAGGCGTGCGTTACAATCTGCAGATGTCAATCAAGACAGATACATAGGTGAAGAAGAACTCGACAACCTTGTAGAGTTTGCACAGAAGCATTTGGGTGTCAAAATCGTACACTTTTGA

Protein Analysis

95

Amino Acids

11.02

Weight (kDa)

6.74

Isoelectric Point (pI)

48.78

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
EF-hand_7 PF13499 11 - 45 1.2e-06 EF-hand domain pair
EF-hand_6 PF13405 20 - 49 5.7e-07 EF-hand domain
EF-hand_1 PF00036 20 - 47 4.3e-06 EF hand domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 6
AccBSI CCGCTC 1 cut(s) 138
AciI CCGC 2 cut(s) 124, 136
AcsI RAATTY 1 cut(s) 80
AcuI CTGAAG 1 cut(s) 95
AfaI GTAC 1 cut(s) 279
AflIII ACRYGT 1 cut(s) 40
AgsI TTSAA 2 cut(s) 64, 166
AjnI CCWGG 1 cut(s) 126
AluBI AGCT 1 cut(s) 153
AluI AGCT 1 cut(s) 153
ApoI RAATTY 1 cut(s) 80
AsuHPI GGTGA 1 cut(s) 230
BaeI ACNNNNGTAYC 2 cut(s) 202, 235
BccI CCATC 1 cut(s) 26
BcgI CGANNNNNNTGC 4 cut(s) 4, 38, 137, 171
BciT130I CCWGG 1 cut(s) 128
BfaI CTAG 1 cut(s) 27
BfmI CTRYAG 1 cut(s) 189
BfuAI ACCTGC 1 cut(s) 6
Bme1390I CCNGG 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 128
BsaBI GATNNNNATC 1 cut(s) 198
BsaJI CCNNGG 1 cut(s) 54
Bse1I ACTGG 1 cut(s) 148
Bse8I GATNNNNATC 1 cut(s) 198
BseBI CCWGG 1 cut(s) 128
BseDI CCNNGG 1 cut(s) 54
BseJI GATNNNNATC 1 cut(s) 198
BseNI ACTGG 1 cut(s) 148
BseRI GAGGAG 1 cut(s) 71
BspACI CCGC 2 cut(s) 124, 136
BspMAI CTGCAG 1 cut(s) 193
BspMI ACCTGC 1 cut(s) 6
BsrBI CCGCTC 1 cut(s) 138
BsrI ACTGG 1 cut(s) 148
BssECI CCNNGG 1 cut(s) 54
Bst2UI CCWGG 1 cut(s) 128
Bst4CI ACNGT 1 cut(s) 104
BstC8I GCNNGC 2 cut(s) 173, 177
BstMWI GCNNNNNNNGC 1 cut(s) 144
BstNI CCWGG 1 cut(s) 128
BstSCI CCNGG 1 cut(s) 126
BstSFI CTRYAG 1 cut(s) 189
BtsIMutI CAGTG 1 cut(s) 141
BveI ACCTGC 1 cut(s) 6
Cac8I GCNNGC 2 cut(s) 173, 177
Csp6I GTAC 1 cut(s) 278
CviJI RGCY 3 cut(s) 73, 131, 153
CviKI_1 RGCY 3 cut(s) 73, 131, 153
CviQI GTAC 1 cut(s) 278
EciI GGCGGA 1 cut(s) 113
Eco57I CTGAAG 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 126
FaiI YATR 3 cut(s) 47, 107, 215
FspBI CTAG 1 cut(s) 27
HindIII AAGCTT 1 cut(s) 151
HphI GGTGA 1 cut(s) 230
Hpy166II GTNNAC 1 cut(s) 280
Hpy188III TCNNGA 2 cut(s) 166, 203
Hpy8I GTNNAC 1 cut(s) 280
HpyCH4III ACNGT 1 cut(s) 104
HpyCH4IV ACGT 2 cut(s) 40, 161
HpyCH4V TGCA 2 cut(s) 191, 251
HpyF10VI GCNNNNNNNGC 1 cut(s) 144
HpySE526I ACGT 2 cut(s) 40, 161
LmnI GCTCC 1 cut(s) 143
LpnPI CCDG 4 cut(s) 113, 129, 140, 157
MaeI CTAG 1 cut(s) 27
MaeII ACGT 2 cut(s) 40, 161
MaeIII GTNAC 1 cut(s) 180
MbiI CCGCTC 1 cut(s) 138
MboII GAAGA 4 cut(s) 76, 88, 233, 236
MluCI AATT 1 cut(s) 80
MnlI CCTC 2 cut(s) 49, 109
MseI TTAA 1 cut(s) 9
MslI CAYNNNNRTG 1 cut(s) 264
MspR9I CCNGG 1 cut(s) 128
MvaI CCWGG 1 cut(s) 128
MwoI GCNNNNNNNGC 1 cut(s) 144
Psp6I CCWGG 1 cut(s) 126
PspGI CCWGG 1 cut(s) 126
PstI CTGCAG 1 cut(s) 193
RsaI GTAC 1 cut(s) 279
RsaNI GTAC 1 cut(s) 278
RseI CAYNNNNRTG 1 cut(s) 264
SaqAI TTAA 1 cut(s) 9
ScrFI CCNGG 1 cut(s) 128
SetI ASST 6 cut(s) 20, 43, 155, 164, 220, 240
SfcI CTRYAG 1 cut(s) 189
SmiMI CAYNNNNRTG 1 cut(s) 264
Sse9I AATT 1 cut(s) 80
SsiI CCGC 2 cut(s) 124, 136
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 1 cut(s) 126
TaaI ACNGT 1 cut(s) 104
TaiI ACGT 2 cut(s) 43, 164
TaqI TCGA 1 cut(s) 231
TasI AATT 1 cut(s) 80
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
TscAI CASTG 1 cut(s) 148
TspRI CASTG 1 cut(s) 148
XapI RAATTY 1 cut(s) 80
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.