Rmu_sc0000031.1_g000032

EF hand

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000031.1
Physical Location & Seq
Reverse (-)
173142 .. 173429
288 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000031.1_g000032.1.cds

Sequence Viewer

Length: 288 bp
atggcgattaagagcaagtgtgtcgctagtgatggcaaacgtattatgaccaccgaggagttgaagaaatggctgaagaaatttgatactgacaaagatggccgtataagcaaagaggaactccgccaggctatccgctccaccggcggacggtttgccacgttcaagagcaggcgtgggttacgatctgcagatgtcaatcaagacggatacataggtgaagaagaactcgacaaccttgtagagtttgcacagaagtatttgggtgtcaggatcatacacttttga

Protein Analysis

95

Amino Acids

10.93

Weight (kDa)

9.52

Isoelectric Point (pI)

47.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 138
AciI CCGC 3 cut(s) 124, 136, 147
AclWI GGATC 1 cut(s) 281
AcoI YGGCCR 1 cut(s) 100
AcsI RAATTY 1 cut(s) 80
AcuI CTGAAG 1 cut(s) 95
AfiI CCNNNNNNNGG 1 cut(s) 150
AgsI TTSAA 2 cut(s) 64, 166
AjnI CCWGG 1 cut(s) 126
AlwI GGATC 1 cut(s) 281
AoxI GGCC 1 cut(s) 100
ApoI RAATTY 1 cut(s) 80
AsuHPI GGTGA 1 cut(s) 230
BaeI ACNNNNGTAYC 2 cut(s) 202, 235
BccI CCATC 2 cut(s) 26, 92
BceAI ACGGC 1 cut(s) 87
BcgI CGANNNNNNTGC 2 cut(s) 4, 38
BciT130I CCWGG 1 cut(s) 128
BciVI GTATCC 1 cut(s) 203
BfaI CTAG 1 cut(s) 27
BfmI CTRYAG 1 cut(s) 189
BfuI GTATCC 1 cut(s) 203
Bme1390I CCNGG 1 cut(s) 128
BmrFI CCNGG 1 cut(s) 128
BsaBI GATNNNNATC 1 cut(s) 198
BsaJI CCNNGG 1 cut(s) 54
Bsc4I CCNNNNNNNGG 1 cut(s) 150
Bse118I RCCGGY 1 cut(s) 143
Bse8I GATNNNNATC 1 cut(s) 198
BseBI CCWGG 1 cut(s) 128
BseDI CCNNGG 1 cut(s) 54
BseJI GATNNNNATC 1 cut(s) 198
BseLI CCNNNNNNNGG 1 cut(s) 150
BseRI GAGGAG 1 cut(s) 71
BshFI GGCC 1 cut(s) 102
BsiSI CCGG 1 cut(s) 144
BslI CCNNNNNNNGG 1 cut(s) 150
BsnI GGCC 1 cut(s) 102
Bsp143I GATC 2 cut(s) 185, 273
BspACI CCGC 3 cut(s) 124, 136, 147
BspANI GGCC 1 cut(s) 102
BspMAI CTGCAG 1 cut(s) 193
BspPI GGATC 1 cut(s) 281
BsrBI CCGCTC 1 cut(s) 138
BsrFI RCCGGY 1 cut(s) 143
BssAI RCCGGY 1 cut(s) 143
BssECI CCNNGG 1 cut(s) 54
BssMI GATC 2 cut(s) 185, 273
Bst2UI CCWGG 1 cut(s) 128
Bst4CI ACNGT 1 cut(s) 153
BstC8I GCNNGC 1 cut(s) 173
BstKTI GATC 2 cut(s) 188, 276
BstMBI GATC 2 cut(s) 185, 273
BstMWI GCNNNNNNNGC 2 cut(s) 108, 144
BstNI CCWGG 1 cut(s) 128
BstSCI CCNGG 1 cut(s) 126
BstSFI CTRYAG 1 cut(s) 189
BsuI GTATCC 1 cut(s) 203
BsuRI GGCC 1 cut(s) 102
Cac8I GCNNGC 1 cut(s) 173
Cfr10I RCCGGY 1 cut(s) 143
CviJI RGCY 3 cut(s) 73, 102, 131
CviKI_1 RGCY 3 cut(s) 73, 102, 131
DpnI GATC 2 cut(s) 187, 275
DpnII GATC 2 cut(s) 185, 273
EaeI YGGCCR 1 cut(s) 100
EciI GGCGGA 2 cut(s) 113, 162
Eco57I CTGAAG 1 cut(s) 95
EcoRII CCWGG 1 cut(s) 126
FaiI YATR 4 cut(s) 47, 107, 215, 278
FspBI CTAG 1 cut(s) 27
HaeIII GGCC 1 cut(s) 102
HapII CCGG 1 cut(s) 144
HpaII CCGG 1 cut(s) 144
HphI GGTGA 1 cut(s) 230
Hpy188III TCNNGA 3 cut(s) 166, 203, 271
HpyCH4III ACNGT 1 cut(s) 153
HpyCH4IV ACGT 2 cut(s) 40, 161
HpyCH4V TGCA 2 cut(s) 191, 251
HpyF10VI GCNNNNNNNGC 2 cut(s) 108, 144
HpySE526I ACGT 2 cut(s) 40, 161
Kzo9I GATC 2 cut(s) 185, 273
LmnI GCTCC 1 cut(s) 143
LpnPI CCDG 5 cut(s) 113, 140, 157, 157, 256
MaeI CTAG 1 cut(s) 27
MaeII ACGT 2 cut(s) 40, 161
MaeIII GTNAC 1 cut(s) 180
MalI GATC 2 cut(s) 187, 275
MbiI CCGCTC 1 cut(s) 138
MboI GATC 2 cut(s) 185, 273
MboII GAAGA 4 cut(s) 76, 88, 233, 236
MluCI AATT 1 cut(s) 80
MnlI CCTC 2 cut(s) 49, 109
MseI TTAA 1 cut(s) 9
MspI CCGG 1 cut(s) 144
MspR9I CCNGG 1 cut(s) 128
MvaI CCWGG 1 cut(s) 128
MwoI GCNNNNNNNGC 2 cut(s) 108, 144
NdeII GATC 2 cut(s) 185, 273
Psp6I CCWGG 1 cut(s) 126
PspGI CCWGG 1 cut(s) 126
PstI CTGCAG 1 cut(s) 193
SaqAI TTAA 1 cut(s) 9
Sau3AI GATC 2 cut(s) 185, 273
ScrFI CCNGG 1 cut(s) 128
SetI ASST 4 cut(s) 43, 164, 220, 240
SfcI CTRYAG 1 cut(s) 189
SgrAI CRCCGGYG 1 cut(s) 143
Sse9I AATT 1 cut(s) 80
SsiI CCGC 3 cut(s) 124, 136, 147
SspMI CTAG 1 cut(s) 27
StyD4I CCNGG 1 cut(s) 126
TaaI ACNGT 1 cut(s) 153
TaiI ACGT 2 cut(s) 43, 164
TaqI TCGA 1 cut(s) 231
TasI AATT 1 cut(s) 80
Tru1I TTAA 1 cut(s) 9
Tru9I TTAA 1 cut(s) 9
TspGWI ACGGA 1 cut(s) 222
XapI RAATTY 1 cut(s) 80
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.