RLG00000001446

Component of the coenzyme Q biosynthetic pathway. May play a role in organizing a multi-subunit COQ enzyme complex required for coenzyme Q biosynthesis. Required for steady-state levels of other COQ polypeptides

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
OG0005151
Physical Location & Seq
Forward (+)
15687577 .. 15688186
610 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000001446

Sequence Viewer

Length: 498 bp
ATGGTCATACTGTTGAAGCAACCCCGTGTAATATCTACAAATGTGGGTTATGCATGGGATCTTCTGCCGAATACATTTGGTGCTACCTATGCAAAGTTCATGGGATCTAGGAACTACTCTCCAGATGATCGACCACCAGTGCATTTCATTGAAACATATGAACTTGCATATGTGGCCATGACGGCTTGTGAGGTGCACGACTTCTGGCACACTCTCTTTGACCTTCCAACAAACTTGATGGGTGAGTCAGCACTCAAAATAATAGAGTTTCAGCAAATGTACCTTCCCATGTGCTTGATGTCCGCTATAGGAGGCTCCGTGAGGTTCAACGAGAAGCAAAGAAAATTGTTCTTCCAGCACTACTTTCCTTGGGCCCTTAGAGCTGGTACGCAATCAACATATGTCATGTGTATTTATTATGAGAAACACTTTCATGAGGATTTGGAGGATGTTTGGAGAAAGTGGGGTATAACTCCTGCTTCTGTAGCTCCTAAATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Coq4

Protein Analysis

166

Amino Acids

19.28

Weight (kDa)

6.58

Isoelectric Point (pI)

47.25

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Coq4 PF05019 3 - 159 1e-55 Coenzyme Q (ubiquinone) biosynthesis protein Coq4
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 303
AclWI GGATC 2 cut(s) 66, 112
AcoI YGGCCR 1 cut(s) 174
AfaI GTAC 2 cut(s) 281, 388
AgsI TTSAA 3 cut(s) 16, 152, 328
AluBI AGCT 2 cut(s) 383, 488
AluI AGCT 2 cut(s) 383, 488
Alw21I GWGCWC 1 cut(s) 198
Alw44I GTGCAC 1 cut(s) 194
AlwI GGATC 2 cut(s) 66, 112
AoxI GGCC 2 cut(s) 174, 372
ApaI GGGCCC 1 cut(s) 376
ApaLI GTGCAC 1 cut(s) 194
AspS9I GGNCC 2 cut(s) 372, 373
AsuHPI GGTGA 1 cut(s) 254
BaeGI GKGCMC 2 cut(s) 198, 376
BalI TGGCCA 1 cut(s) 176
BanII GRGCYC 1 cut(s) 376
Bbv12I GWGCWC 1 cut(s) 198
BccI CCATC 1 cut(s) 232
BceAI ACGGC 1 cut(s) 198
BfaI CTAG 1 cut(s) 108
BfmI CTRYAG 2 cut(s) 306, 483
BglI GCCNNNNNGGC 1 cut(s) 182
BmgT120I GGNCC 2 cut(s) 372, 373
BmiI GGNNCC 2 cut(s) 316, 374
BpmI CTGGAG 1 cut(s) 105
BsaJI CCNNGG 1 cut(s) 368
BsaXI ACNNNNNCTCC 2 cut(s) 303, 333
Bse1I ACTGG 1 cut(s) 137
BseDI CCNNGG 1 cut(s) 368
BseGI GGATG 1 cut(s) 454
BseNI ACTGG 1 cut(s) 137
BseSI GKGCMC 2 cut(s) 198, 376
BshFI GGCC 2 cut(s) 176, 374
BsiHKAI GWGCWC 1 cut(s) 198
BsnI GGCC 2 cut(s) 176, 374
Bsp120I GGGCCC 1 cut(s) 372
Bsp1286I GDGCHC 2 cut(s) 198, 376
Bsp143I GATC 3 cut(s) 58, 104, 127
BspACI CCGC 1 cut(s) 303
BspANI GGCC 2 cut(s) 176, 374
BspHI TCATGA 1 cut(s) 433
BspLI GGNNCC 2 cut(s) 316, 374
BspPI GGATC 2 cut(s) 66, 112
BsrI ACTGG 1 cut(s) 137
BssECI CCNNGG 1 cut(s) 368
BssMI GATC 3 cut(s) 58, 104, 127
BssT1I CCWWGG 1 cut(s) 368
Bst4CI ACNGT 1 cut(s) 12
BstDEI CTNAG 1 cut(s) 377
BstF5I GGATG 1 cut(s) 454
BstKTI GATC 3 cut(s) 61, 107, 130
BstMBI GATC 3 cut(s) 58, 104, 127
BstMWI GCNNNNNNNGC 5 cut(s) 89, 173, 182, 380, 485
BstSFI CTRYAG 2 cut(s) 306, 483
BstSLI GKGCMC 2 cut(s) 198, 376
BstX2I RGATCY 2 cut(s) 58, 104
BstYI RGATCY 2 cut(s) 58, 104
BsuRI GGCC 2 cut(s) 176, 374
BtsCI GGATG 1 cut(s) 454
BtsIMutI CAGTG 1 cut(s) 144
CciI TCATGA 1 cut(s) 433
Cfr13I GGNCC 2 cut(s) 372, 373
Csp6I GTAC 2 cut(s) 280, 387
CviAII CATG 6 cut(s) 54, 100, 178, 289, 406, 434
CviJI RGCY 6 cut(s) 176, 185, 315, 374, 383, 488
CviKI_1 RGCY 6 cut(s) 176, 185, 315, 374, 383, 488
CviQI GTAC 2 cut(s) 280, 387
DdeI CTNAG 1 cut(s) 377
DpnI GATC 3 cut(s) 60, 106, 129
DpnII GATC 3 cut(s) 58, 104, 127
EaeI YGGCCR 1 cut(s) 174
Eco130I CCWWGG 1 cut(s) 368
Eco24I GRGCYC 1 cut(s) 376
EcoO109I RGGNCCY 1 cut(s) 373
EcoT14I CCWWGG 1 cut(s) 368
EcoT22I ATGCAT 1 cut(s) 55
EcoT38I GRGCYC 1 cut(s) 376
ErhI CCWWGG 1 cut(s) 368
FaeI CATG 6 cut(s) 57, 103, 181, 292, 409, 437
FatI CATG 6 cut(s) 53, 99, 177, 288, 405, 433
FauNDI CATATG 3 cut(s) 157, 169, 400
FokI GGATG 1 cut(s) 461
FriOI GRGCYC 1 cut(s) 376
FspBI CTAG 1 cut(s) 108
GsuI CTGGAG 1 cut(s) 105
HaeIII GGCC 2 cut(s) 176, 374
Hin1II CATG 6 cut(s) 57, 103, 181, 292, 409, 437
HinfI GANTC 1 cut(s) 245
HphI GGTGA 1 cut(s) 254
Hpy166II GTNNAC 1 cut(s) 196
Hpy188III TCNNGA 2 cut(s) 122, 434
Hpy8I GTNNAC 1 cut(s) 196
HpyAV CCTTC 2 cut(s) 233, 293
HpyCH4III ACNGT 1 cut(s) 12
HpyCH4V TGCA 5 cut(s) 53, 92, 142, 167, 196
HpyF10VI GCNNNNNNNGC 5 cut(s) 89, 173, 182, 380, 485
HpyF3I CTNAG 1 cut(s) 377
Hsp92II CATG 6 cut(s) 57, 103, 181, 292, 409, 437
Kzo9I GATC 3 cut(s) 58, 104, 127
LmnI GCTCC 2 cut(s) 320, 493
LpnPI CCDG 6 cut(s) 135, 150, 190, 368, 369, 489
MaeI CTAG 1 cut(s) 108
MalI GATC 3 cut(s) 60, 106, 129
MboI GATC 3 cut(s) 58, 104, 127
MboII GAAGA 2 cut(s) 53, 343
MflI RGATCY 2 cut(s) 58, 104
MhlI GDGCHC 2 cut(s) 198, 376
MlsI TGGCCA 1 cut(s) 176
MluCI AATT 1 cut(s) 344
MluNI TGGCCA 1 cut(s) 176
MlyI GAGTC 1 cut(s) 254
MmeI TCCRAC 1 cut(s) 251
MnlI CCTC 5 cut(s) 184, 305, 315, 430, 439
Mox20I TGGCCA 1 cut(s) 176
Mph1103I ATGCAT 1 cut(s) 55
MscI TGGCCA 1 cut(s) 176
MslI CAYNNNNRTG 1 cut(s) 432
Msp20I TGGCCA 1 cut(s) 176
MwoI GCNNNNNNNGC 5 cut(s) 89, 173, 182, 380, 485
NdeI CATATG 3 cut(s) 157, 169, 400
NdeII GATC 3 cut(s) 58, 104, 127
NlaIII CATG 6 cut(s) 57, 103, 181, 292, 409, 437
NlaIV GGNNCC 2 cut(s) 316, 374
NsiI ATGCAT 1 cut(s) 55
PagI TCATGA 1 cut(s) 433
PleI GAGTC 1 cut(s) 253
PpsI GAGTC 1 cut(s) 253
PspN4I GGNNCC 2 cut(s) 316, 374
PspOMI GGGCCC 1 cut(s) 372
PspPI GGNCC 2 cut(s) 372, 373
PsuI RGATCY 2 cut(s) 58, 104
RsaI GTAC 2 cut(s) 281, 388
RsaNI GTAC 2 cut(s) 280, 387
RseI CAYNNNNRTG 1 cut(s) 432
Sau3AI GATC 3 cut(s) 58, 104, 127
Sau96I GGNCC 2 cut(s) 372, 373
SchI GAGTC 1 cut(s) 254
SduI GDGCHC 2 cut(s) 198, 376
SetI ASST 7 cut(s) 89, 195, 225, 285, 326, 385, 490
SfcI CTRYAG 2 cut(s) 306, 483
SmiMI CAYNNNNRTG 1 cut(s) 432
Sse9I AATT 1 cut(s) 344
SsiI CCGC 1 cut(s) 303
SspMI CTAG 1 cut(s) 108
StyI CCWWGG 1 cut(s) 368
TaaI ACNGT 1 cut(s) 12
TaqI TCGA 1 cut(s) 130
TasI AATT 1 cut(s) 344
TscAI CASTG 1 cut(s) 144
TspDTI ATGAA 4 cut(s) 88, 136, 174, 422
TspGWI ACGGA 1 cut(s) 307
TspRI CASTG 1 cut(s) 144
VneI GTGCAC 1 cut(s) 194
XspI CTAG 1 cut(s) 108
Zsp2I ATGCAT 1 cut(s) 55
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.