RLG00000005568

Coiled-coil domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr1
Physical Location & Seq
Reverse (-)
68591820 .. 68594128
2309 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000005568

Sequence Viewer

Length: 555 bp
ATGCATACTCTCGCATCCTCCTCCTGCTGCTCCTGCTCCTGCTCCTGCTGTCTGCGATTTAGTACCTCGATTAGGCAAATGGCTGCTGAAGAGGACTCCCTCGAAGAAATCGTTGCAGCACGAAAGGAGAGGCTCAGAGCCCTCAAAGCTGCACAGCAACTGTTAAACACTCCAGATGAGGACTCTGCTCAACTTGAAAGTAACACTAACGATGACCAGGAAAAGAGCAATGAAACTCCTGATGGGGATGAAACTACCAACATGAAATTCCGAAATTATGTTCCTCATGATAAGAAGCTTCAGGAAGGGAAGCTAGATCCACCAAAACCATCCAAGTTTGAAGACCCTGTTGCAGCAGTGCCTCCTCCATCAGAGAAGAAAGAGGACCCATTCGTGAATATTGCTCCTAAAAAACCAAACTGGGAACTTCGTAGGGATGTGCAGAAGAAGCTTGATAAGCTTGAAAGGCGAACCCAGAAGGCAATGTATAAACTTATGGAACAAGAAAAGCAGAGGCAACTGGATGAAGACAGCATCAATGGTGCAGGGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

185

Amino Acids

20.9

Weight (kDa)

5.3

Isoelectric Point (pI)

62.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
cwf18 PF08315 33 - 168 9.3e-32 cwf18 pre-mRNA splicing factor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 311
AcsI RAATTY 1 cut(s) 266
AcuI CTGAAG 2 cut(s) 108, 284
AfaI GTAC 1 cut(s) 64
AfiI CCNNNNNNNGG 1 cut(s) 72
AgsI TTSAA 3 cut(s) 197, 341, 464
AjnI CCWGG 1 cut(s) 216
AjuI GAANNNNNNNTTGG 2 cut(s) 251, 283
AluBI AGCT 5 cut(s) 149, 298, 313, 451, 460
AluI AGCT 5 cut(s) 149, 298, 313, 451, 460
AlwI GGATC 1 cut(s) 311
AlwNI CAGNNNCTG 1 cut(s) 160
ApeKI GCWGC 5 cut(s) 27, 83, 116, 149, 353
ApoI RAATTY 1 cut(s) 266
AspS9I GGNCC 1 cut(s) 385
AvaII GGWCC 1 cut(s) 385
BanII GRGCYC 1 cut(s) 142
BbsI GAAGAC 2 cut(s) 348, 534
BbvI GCAGC 5 cut(s) 14, 70, 128, 136, 365
BccI CCATC 3 cut(s) 236, 337, 376
BciT130I CCWGG 1 cut(s) 218
BfaI CTAG 2 cut(s) 314, 553
BisI GCNGC 5 cut(s) 28, 84, 117, 150, 354
BlsI GCNGC 5 cut(s) 29, 85, 118, 151, 355
Bme1390I CCNGG 1 cut(s) 218
Bme18I GGWCC 1 cut(s) 385
BmgT120I GGNCC 1 cut(s) 385
BmiI GGNNCC 1 cut(s) 387
BmrFI CCNGG 1 cut(s) 218
BmrI ACTGGG 1 cut(s) 430
BmsI GCATC 2 cut(s) 23, 543
BmuI ACTGGG 1 cut(s) 430
BpiI GAAGAC 2 cut(s) 348, 534
BpmI CTGGAG 1 cut(s) 156
Bsc4I CCNNNNNNNGG 1 cut(s) 72
Bse1I ACTGG 2 cut(s) 425, 525
Bse3DI GCAATG 2 cut(s) 235, 489
BseBI CCWGG 1 cut(s) 218
BseGI GGATG 5 cut(s) 14, 253, 329, 442, 529
BseLI CCNNNNNNNGG 1 cut(s) 72
BseMI GCAATG 2 cut(s) 235, 489
BseMII CTCAG 1 cut(s) 148
BseNI ACTGG 2 cut(s) 425, 525
BseRI GAGGAG 2 cut(s) 10, 354
BseXI GCAGC 5 cut(s) 14, 70, 128, 136, 365
BsgI GTGCAG 2 cut(s) 135, 461
BslI CCNNNNNNNGG 1 cut(s) 72
Bsp1286I GDGCHC 1 cut(s) 142
Bsp143I GATC 1 cut(s) 316
BspCNI CTCAG 1 cut(s) 147
BspHI TCATGA 1 cut(s) 286
BspLI GGNNCC 1 cut(s) 387
BspPI GGATC 1 cut(s) 311
BsrDI GCAATG 2 cut(s) 235, 489
BsrI ACTGG 2 cut(s) 425, 525
BssMI GATC 1 cut(s) 316
Bst2UI CCWGG 1 cut(s) 218
Bst4CI ACNGT 1 cut(s) 162
Bst6I CTCTTC 1 cut(s) 84
BstDEI CTNAG 1 cut(s) 134
BstENI CCTNNNNNAGG 1 cut(s) 70
BstF5I GGATG 5 cut(s) 14, 253, 329, 442, 529
BstKTI GATC 1 cut(s) 319
BstMBI GATC 1 cut(s) 316
BstMWI GCNNNNNNNGC 5 cut(s) 33, 146, 448, 457, 466
BstNI CCWGG 1 cut(s) 218
BstSCI CCNGG 1 cut(s) 216
BstV1I GCAGC 5 cut(s) 14, 70, 128, 136, 365
BstV2I GAAGAC 2 cut(s) 348, 534
BstX2I RGATCY 1 cut(s) 316
BstYI RGATCY 1 cut(s) 316
BtsCI GGATG 5 cut(s) 14, 253, 329, 442, 529
BtsI GCAGTG 1 cut(s) 363
BtsIMutI CAGTG 1 cut(s) 363
CaiI CAGNNNCTG 1 cut(s) 160
CciI TCATGA 1 cut(s) 286
Cfr13I GGNCC 1 cut(s) 385
Csp6I GTAC 1 cut(s) 63
CviAII CATG 2 cut(s) 262, 287
CviJI RGCY 8 cut(s) 83, 133, 140, 149, 298, 313, 451, 460
CviKI_1 RGCY 8 cut(s) 83, 133, 140, 149, 298, 313, 451, 460
CviQI GTAC 1 cut(s) 63
DdeI CTNAG 1 cut(s) 134
DpnI GATC 1 cut(s) 318
DpnII GATC 1 cut(s) 316
Eam1104I CTCTTC 1 cut(s) 84
EarI CTCTTC 1 cut(s) 84
Eco24I GRGCYC 1 cut(s) 142
Eco47I GGWCC 1 cut(s) 385
Eco57I CTGAAG 2 cut(s) 108, 284
EcoNI CCTNNNNNAGG 1 cut(s) 70
EcoO109I RGGNCCY 1 cut(s) 385
EcoRII CCWGG 1 cut(s) 216
EcoT22I ATGCAT 1 cut(s) 6
EcoT38I GRGCYC 1 cut(s) 142
FaeI CATG 2 cut(s) 265, 290
FaiI YATR 6 cut(s) 6, 263, 279, 288, 489, 497
FatI CATG 2 cut(s) 261, 286
Fnu4HI GCNGC 5 cut(s) 28, 84, 117, 150, 354
FokI GGATG 4 cut(s) 260, 316, 449, 536
FriOI GRGCYC 1 cut(s) 142
Fsp4HI GCNGC 5 cut(s) 28, 84, 117, 150, 354
FspBI CTAG 2 cut(s) 314, 553
GluI GCNGC 5 cut(s) 28, 84, 117, 150, 354
GsuI CTGGAG 1 cut(s) 156
Hin1II CATG 2 cut(s) 265, 290
HindIII AAGCTT 3 cut(s) 296, 449, 458
HinfI GANTC 2 cut(s) 95, 182
Hpy188I TCNGA 3 cut(s) 137, 272, 373
Hpy188III TCNNGA 5 cut(s) 173, 239, 287, 302, 394
HpyAV CCTTC 2 cut(s) 299, 472
HpyCH4III ACNGT 1 cut(s) 162
HpyCH4V TGCA 6 cut(s) 4, 116, 152, 353, 442, 545
HpyF10VI GCNNNNNNNGC 5 cut(s) 33, 146, 448, 457, 466
HpyF3I CTNAG 1 cut(s) 134
Hsp92II CATG 2 cut(s) 265, 290
Kzo9I GATC 1 cut(s) 316
LmnI GCTCC 4 cut(s) 35, 41, 47, 409
Lsp1109I GCAGC 5 cut(s) 14, 70, 128, 136, 365
LweI GCATC 2 cut(s) 23, 543
MaeI CTAG 2 cut(s) 314, 553
MaeIII GTNAC 1 cut(s) 200
MalI GATC 1 cut(s) 318
MboI GATC 1 cut(s) 316
MboII GAAGA 6 cut(s) 101, 116, 353, 388, 457, 539
MflI RGATCY 1 cut(s) 316
MhlI GDGCHC 1 cut(s) 142
MluCI AATT 2 cut(s) 266, 274
MlyI GAGTC 2 cut(s) 89, 176
Mph1103I ATGCAT 1 cut(s) 6
MseI TTAA 1 cut(s) 164
MspR9I CCNGG 1 cut(s) 218
MvaI CCWGG 1 cut(s) 218
MwoI GCNNNNNNNGC 5 cut(s) 33, 146, 448, 457, 466
NdeII GATC 1 cut(s) 316
NlaIII CATG 2 cut(s) 265, 290
NlaIV GGNNCC 1 cut(s) 387
NsiI ATGCAT 1 cut(s) 6
PagI TCATGA 1 cut(s) 286
PcsI WCGNNNNNNNCGW 1 cut(s) 108
PkrI GCNGC 5 cut(s) 29, 85, 118, 151, 355
PleI GAGTC 2 cut(s) 89, 176
PpsI GAGTC 2 cut(s) 89, 176
PpuMI RGGWCCY 1 cut(s) 385
Psp5II RGGWCCY 1 cut(s) 385
Psp6I CCWGG 1 cut(s) 216
PspGI CCWGG 1 cut(s) 216
PspN4I GGNNCC 1 cut(s) 387
PspPI GGNCC 1 cut(s) 385
PspPPI RGGWCCY 1 cut(s) 385
PstNI CAGNNNCTG 1 cut(s) 160
PsuI RGATCY 1 cut(s) 316
RsaI GTAC 1 cut(s) 64
RsaNI GTAC 1 cut(s) 63
SaqAI TTAA 1 cut(s) 164
SatI GCNGC 5 cut(s) 28, 84, 117, 150, 354
Sau3AI GATC 1 cut(s) 316
Sau96I GGNCC 1 cut(s) 385
SchI GAGTC 2 cut(s) 89, 176
ScrFI CCNGG 1 cut(s) 218
SduI GDGCHC 1 cut(s) 142
SetI ASST 6 cut(s) 68, 151, 300, 315, 453, 462
SfaNI GCATC 2 cut(s) 23, 543
SinI GGWCC 1 cut(s) 385
Sse9I AATT 2 cut(s) 266, 274
SspI AATATT 1 cut(s) 400
SspMI CTAG 2 cut(s) 314, 553
StyD4I CCNGG 1 cut(s) 216
TaaI ACNGT 1 cut(s) 162
TaqI TCGA 2 cut(s) 68, 102
TasI AATT 2 cut(s) 266, 274
Tru1I TTAA 1 cut(s) 164
Tru9I TTAA 1 cut(s) 164
TscAI CASTG 1 cut(s) 363
TseI GCWGC 5 cut(s) 27, 83, 116, 149, 353
TspDTI ATGAA 4 cut(s) 246, 264, 278, 540
TspRI CASTG 1 cut(s) 363
VpaK11BI GGWCC 1 cut(s) 385
XagI CCTNNNNNAGG 1 cut(s) 70
XapI RAATTY 1 cut(s) 266
XspI CTAG 2 cut(s) 314, 553
Zsp2I ATGCAT 1 cut(s) 6
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.