Rroxscaffold_3G00276210

Coiled-coil domain-containing protein

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000003
Physical Location & Seq
Reverse (-)
67476785 .. 67479241
2457 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_3G00276210.1

Sequence Viewer

Length: 477 bp
ATGGCTGCTGAAGAGGACTCCCTCGAAGAAATCGTTGCGGCACGAAAGGAGAGGCTGAGAGCCCTCAAAGCTGCACAGCAACTGTTAAACACTCCAGATGAGGACTCTGCTCAACTTGAAAGTAACACTAACGATGACCAGGAAAAGAGCAATGAAACTCCTGATGGGGATGATACTACCAACATGAAATTCCGAAATTATGTTCCTCATGATAAGAAGCTTCAGGAAGGGAAGCTAGATCCACCAAAACCATCCAAGTTTGAAGACCCTGTTGCAGCAGTGCCTCCTCCATCAGAGAAGAAAGAGGACCCATTCGTGAATATTGCTCCTAAAAAACCAAACTGGGAACTTCGTAGGGATGTCCAGAAGAAGCTTGATAAGCTTGAAAGGCGAACCCAGAAGGCAATGTGTAAACTTATGGAACAAGAAAAGCAGAGGCAACTGGATGAAGACAGCATCAATGGTGCAGGGGACTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

158

Amino Acids

18.04

Weight (kDa)

4.99

Isoelectric Point (pI)

50.73

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
cwf18 PF08315 7 - 142 7.8e-32 cwf18 pre-mRNA splicing factor
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 38
AclWI GGATC 1 cut(s) 233
AcsI RAATTY 1 cut(s) 188
AcuI CTGAAG 2 cut(s) 30, 206
AgsI TTSAA 3 cut(s) 119, 263, 386
AjnI CCWGG 1 cut(s) 138
AjuI GAANNNNNNNTTGG 2 cut(s) 173, 205
AluBI AGCT 5 cut(s) 71, 220, 235, 373, 382
AluI AGCT 5 cut(s) 71, 220, 235, 373, 382
AlwI GGATC 1 cut(s) 233
AlwNI CAGNNNCTG 1 cut(s) 82
ApeKI GCWGC 3 cut(s) 5, 71, 275
ApoI RAATTY 1 cut(s) 188
AspS9I GGNCC 1 cut(s) 307
AvaII GGWCC 1 cut(s) 307
BanII GRGCYC 1 cut(s) 64
BbsI GAAGAC 2 cut(s) 270, 456
BbvI GCAGC 2 cut(s) 58, 287
BccI CCATC 3 cut(s) 158, 259, 298
BciT130I CCWGG 1 cut(s) 140
BfaI CTAG 2 cut(s) 236, 475
BisI GCNGC 4 cut(s) 6, 39, 72, 276
BlsI GCNGC 4 cut(s) 7, 40, 73, 277
Bme1390I CCNGG 1 cut(s) 140
Bme18I GGWCC 1 cut(s) 307
BmgT120I GGNCC 1 cut(s) 307
BmiI GGNNCC 1 cut(s) 309
BmrFI CCNGG 1 cut(s) 140
BmrI ACTGGG 1 cut(s) 352
BmsI GCATC 1 cut(s) 465
BmuI ACTGGG 1 cut(s) 352
BpiI GAAGAC 2 cut(s) 270, 456
BpmI CTGGAG 1 cut(s) 78
Bse1I ACTGG 2 cut(s) 347, 447
Bse3DI GCAATG 2 cut(s) 157, 411
BseBI CCWGG 1 cut(s) 140
BseGI GGATG 4 cut(s) 175, 251, 364, 451
BseMI GCAATG 2 cut(s) 157, 411
BseMII CTCAG 1 cut(s) 47
BseNI ACTGG 2 cut(s) 347, 447
BseRI GAGGAG 1 cut(s) 276
BseXI GCAGC 2 cut(s) 58, 287
BsgI GTGCAG 1 cut(s) 57
Bsp1286I GDGCHC 1 cut(s) 64
Bsp143I GATC 1 cut(s) 238
BspACI CCGC 1 cut(s) 38
BspCNI CTCAG 1 cut(s) 48
BspHI TCATGA 1 cut(s) 208
BspLI GGNNCC 1 cut(s) 309
BspPI GGATC 1 cut(s) 233
BsrDI GCAATG 2 cut(s) 157, 411
BsrI ACTGG 2 cut(s) 347, 447
BssMI GATC 1 cut(s) 238
Bst2UI CCWGG 1 cut(s) 140
Bst4CI ACNGT 1 cut(s) 84
Bst6I CTCTTC 1 cut(s) 6
BstDEI CTNAG 1 cut(s) 56
BstF5I GGATG 4 cut(s) 175, 251, 364, 451
BstKTI GATC 1 cut(s) 241
BstMBI GATC 1 cut(s) 238
BstMWI GCNNNNNNNGC 3 cut(s) 68, 379, 388
BstNI CCWGG 1 cut(s) 140
BstSCI CCNGG 1 cut(s) 138
BstV1I GCAGC 2 cut(s) 58, 287
BstV2I GAAGAC 2 cut(s) 270, 456
BstX2I RGATCY 1 cut(s) 238
BstYI RGATCY 1 cut(s) 238
BtsCI GGATG 4 cut(s) 175, 251, 364, 451
BtsI GCAGTG 1 cut(s) 285
BtsIMutI CAGTG 1 cut(s) 285
CaiI CAGNNNCTG 1 cut(s) 82
CciI TCATGA 1 cut(s) 208
Cfr13I GGNCC 1 cut(s) 307
CviAII CATG 2 cut(s) 184, 209
CviJI RGCY 8 cut(s) 5, 55, 62, 71, 220, 235, 373, 382
CviKI_1 RGCY 8 cut(s) 5, 55, 62, 71, 220, 235, 373, 382
DdeI CTNAG 1 cut(s) 56
DpnI GATC 1 cut(s) 240
DpnII GATC 1 cut(s) 238
Eam1104I CTCTTC 1 cut(s) 6
EarI CTCTTC 1 cut(s) 6
Eco24I GRGCYC 1 cut(s) 64
Eco47I GGWCC 1 cut(s) 307
Eco57I CTGAAG 2 cut(s) 30, 206
EcoO109I RGGNCCY 1 cut(s) 307
EcoRII CCWGG 1 cut(s) 138
EcoT38I GRGCYC 1 cut(s) 64
FaeI CATG 2 cut(s) 187, 212
FaiI YATR 4 cut(s) 185, 201, 210, 419
FatI CATG 2 cut(s) 183, 208
Fnu4HI GCNGC 4 cut(s) 6, 39, 72, 276
FokI GGATG 4 cut(s) 182, 238, 371, 458
FriOI GRGCYC 1 cut(s) 64
Fsp4HI GCNGC 4 cut(s) 6, 39, 72, 276
FspBI CTAG 2 cut(s) 236, 475
GluI GCNGC 4 cut(s) 6, 39, 72, 276
GsuI CTGGAG 1 cut(s) 78
Hin1II CATG 2 cut(s) 187, 212
HindIII AAGCTT 3 cut(s) 218, 371, 380
HinfI GANTC 2 cut(s) 17, 104
Hpy166II GTNNAC 1 cut(s) 413
Hpy188I TCNGA 2 cut(s) 194, 295
Hpy188III TCNNGA 6 cut(s) 95, 161, 209, 224, 316, 364
Hpy8I GTNNAC 1 cut(s) 413
HpyAV CCTTC 2 cut(s) 221, 394
HpyCH4III ACNGT 1 cut(s) 84
HpyCH4V TGCA 3 cut(s) 74, 275, 467
HpyF10VI GCNNNNNNNGC 3 cut(s) 68, 379, 388
HpyF3I CTNAG 1 cut(s) 56
Hsp92II CATG 2 cut(s) 187, 212
Kzo9I GATC 1 cut(s) 238
LmnI GCTCC 1 cut(s) 331
Lsp1109I GCAGC 2 cut(s) 58, 287
LweI GCATC 1 cut(s) 465
MaeI CTAG 2 cut(s) 236, 475
MaeIII GTNAC 1 cut(s) 122
MalI GATC 1 cut(s) 240
MboI GATC 1 cut(s) 238
MboII GAAGA 6 cut(s) 23, 38, 275, 310, 379, 461
MflI RGATCY 1 cut(s) 238
MhlI GDGCHC 1 cut(s) 64
MluCI AATT 2 cut(s) 188, 196
MlyI GAGTC 2 cut(s) 11, 98
MseI TTAA 1 cut(s) 86
MspR9I CCNGG 1 cut(s) 140
MvaI CCWGG 1 cut(s) 140
MwoI GCNNNNNNNGC 3 cut(s) 68, 379, 388
NdeII GATC 1 cut(s) 238
NlaIII CATG 2 cut(s) 187, 212
NlaIV GGNNCC 1 cut(s) 309
PagI TCATGA 1 cut(s) 208
PcsI WCGNNNNNNNCGW 1 cut(s) 30
PkrI GCNGC 4 cut(s) 7, 40, 73, 277
PleI GAGTC 2 cut(s) 11, 98
PpsI GAGTC 2 cut(s) 11, 98
PpuMI RGGWCCY 1 cut(s) 307
Psp5II RGGWCCY 1 cut(s) 307
Psp6I CCWGG 1 cut(s) 138
PspGI CCWGG 1 cut(s) 138
PspN4I GGNNCC 1 cut(s) 309
PspPI GGNCC 1 cut(s) 307
PspPPI RGGWCCY 1 cut(s) 307
PstNI CAGNNNCTG 1 cut(s) 82
PsuI RGATCY 1 cut(s) 238
SaqAI TTAA 1 cut(s) 86
SatI GCNGC 4 cut(s) 6, 39, 72, 276
Sau3AI GATC 1 cut(s) 238
Sau96I GGNCC 1 cut(s) 307
SchI GAGTC 2 cut(s) 11, 98
ScrFI CCNGG 1 cut(s) 140
SduI GDGCHC 1 cut(s) 64
SetI ASST 5 cut(s) 73, 222, 237, 375, 384
SfaNI GCATC 1 cut(s) 465
SinI GGWCC 1 cut(s) 307
Sse9I AATT 2 cut(s) 188, 196
SsiI CCGC 1 cut(s) 38
SspI AATATT 1 cut(s) 322
SspMI CTAG 2 cut(s) 236, 475
StyD4I CCNGG 1 cut(s) 138
TaaI ACNGT 1 cut(s) 84
TaqI TCGA 1 cut(s) 24
TasI AATT 2 cut(s) 188, 196
TauI GCSGC 1 cut(s) 41
Tru1I TTAA 1 cut(s) 86
Tru9I TTAA 1 cut(s) 86
TscAI CASTG 1 cut(s) 285
TseI GCWGC 3 cut(s) 5, 71, 275
TspDTI ATGAA 3 cut(s) 168, 200, 462
TspRI CASTG 1 cut(s) 285
VpaK11BI GGWCC 1 cut(s) 307
XapI RAATTY 1 cut(s) 188
XspI CTAG 2 cut(s) 236, 475
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.