RLG00000006573

ATP-dependent Clp protease adapter protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr2
OG0004724
Physical Location & Seq
Forward (+)
8640320 .. 8640944
625 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000006573

Sequence Viewer

Length: 363 bp
ATGGCTGTATCAACAACAGCACCTGGTAAAGGAGGAGGATTGTTAGAAAGGCCAGTTATAGAGAAATCCACTCCCGCTTGTGAGTCTGAGTTTGATCTCAGGAAATCGAGGAAAATATCTCCTCCATACTGTGTAATATTGCACAATGACAACTTCAATAAACGGGAAAATGTAGTCCAAGTGCTGATGAAGGTCATCCCGGGCATGACCCTTGACAATGCTGTTAATATCATGCAAGAAGCACACCACAATGGCTTGTCAGTGGTGATCATATGTGCTCAGGCTGATGCCGAAGAACACTGCACACAACTCAGGCACAATGGGCTTCTGAGTTCAATTGAACCCGCAAGTGGGGGATGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ClpS

Protein Analysis

121

Amino Acids

12.95

Weight (kDa)

6.18

Isoelectric Point (pI)

63.47

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ClpS PF02617 40 - 106 2.6e-18 ATP-dependent Clp protease adaptor protein ClpS
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 75, 345
AfiI CCNNNNNNNGG 3 cut(s) 29, 350, 351
AgsI TTSAA 3 cut(s) 157, 336, 341
AjnI CCWGG 1 cut(s) 22
Alw21I GWGCWC 1 cut(s) 280
AlwNI CAGNNNCTG 1 cut(s) 23
Ama87I CYCGRG 1 cut(s) 199
AoxI GGCC 1 cut(s) 50
AsuC2I CCSGG 2 cut(s) 200, 201
AsuHPI GGTGA 1 cut(s) 277
AvaI CYCGRG 1 cut(s) 199
Bbv12I GWGCWC 1 cut(s) 280
BciT130I CCWGG 1 cut(s) 24
BclI TGATCA 1 cut(s) 267
BcnI CCSGG 2 cut(s) 200, 201
Bme1390I CCNGG 3 cut(s) 24, 200, 201
BmeT110I CYCGRG 1 cut(s) 199
BmrFI CCNGG 3 cut(s) 24, 200, 201
BmsI GCATC 1 cut(s) 277
Bpu10I CCTNAGC 1 cut(s) 279
BpuMI CCSGG 2 cut(s) 200, 201
BsaJI CCNNGG 1 cut(s) 199
Bsc4I CCNNNNNNNGG 3 cut(s) 29, 350, 351
Bse1I ACTGG 1 cut(s) 53
BseBI CCWGG 1 cut(s) 24
BseDI CCNNGG 1 cut(s) 199
BseGI GGATG 2 cut(s) 195, 362
BseLI CCNNNNNNNGG 3 cut(s) 29, 350, 351
BseMII CTCAG 5 cut(s) 78, 112, 293, 320, 325
BseNI ACTGG 1 cut(s) 53
BseRI GAGGAG 2 cut(s) 48, 111
BsgI GTGCAG 1 cut(s) 286
BshFI GGCC 1 cut(s) 52
BsiHKAI GWGCWC 1 cut(s) 280
BsiHKCI CYCGRG 1 cut(s) 199
BsiSI CCGG 1 cut(s) 200
BslI CCNNNNNNNGG 3 cut(s) 29, 350, 351
BsnI GGCC 1 cut(s) 52
BsoBI CYCGRG 1 cut(s) 199
Bsp1286I GDGCHC 1 cut(s) 280
Bsp143I GATC 2 cut(s) 94, 267
BspACI CCGC 2 cut(s) 75, 345
BspANI GGCC 1 cut(s) 52
BspCNI CTCAG 5 cut(s) 79, 111, 292, 321, 324
BsrI ACTGG 1 cut(s) 53
BssECI CCNNGG 1 cut(s) 199
BssMI GATC 2 cut(s) 94, 267
Bst2UI CCWGG 1 cut(s) 24
Bst4CI ACNGT 1 cut(s) 131
BstDEI CTNAG 5 cut(s) 87, 98, 279, 311, 329
BstENI CCTNNNNNAGG 1 cut(s) 27
BstF5I GGATG 2 cut(s) 195, 362
BstKTI GATC 2 cut(s) 97, 270
BstMBI GATC 2 cut(s) 94, 267
BstMWI GCNNNNNNNGC 1 cut(s) 322
BstNI CCWGG 1 cut(s) 24
BstSCI CCNGG 3 cut(s) 22, 198, 199
BsuRI GGCC 1 cut(s) 52
BtsCI GGATG 2 cut(s) 195, 362
BtsI GCAGTG 1 cut(s) 298
BtsIMutI CAGTG 2 cut(s) 267, 298
CaiI CAGNNNCTG 1 cut(s) 23
Cfr9I CCCGGG 1 cut(s) 199
CsiI ACCWGGT 1 cut(s) 22
CviAII CATG 2 cut(s) 205, 232
CviJI RGCY 5 cut(s) 5, 52, 255, 284, 325
CviKI_1 RGCY 5 cut(s) 5, 52, 255, 284, 325
DdeI CTNAG 5 cut(s) 87, 98, 279, 311, 329
DpnI GATC 2 cut(s) 96, 269
DpnII GATC 2 cut(s) 94, 267
Eco88I CYCGRG 1 cut(s) 199
EcoNI CCTNNNNNAGG 1 cut(s) 27
EcoRII CCWGG 1 cut(s) 22
FaeI CATG 2 cut(s) 208, 235
FaiI YATR 6 cut(s) 59, 127, 206, 233, 272, 274
FatI CATG 2 cut(s) 204, 231
FauI CCCGC 2 cut(s) 82, 352
FauNDI CATATG 1 cut(s) 272
FbaI TGATCA 1 cut(s) 267
FokI GGATG 1 cut(s) 182
HaeIII GGCC 1 cut(s) 52
HapII CCGG 1 cut(s) 200
Hin1II CATG 2 cut(s) 208, 235
HinfI GANTC 1 cut(s) 83
HpaII CCGG 1 cut(s) 200
HphI GGTGA 1 cut(s) 277
Hpy188I TCNGA 2 cut(s) 88, 330
Hpy188III TCNNGA 1 cut(s) 100
HpyAV CCTTC 1 cut(s) 184
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4V TGCA 3 cut(s) 142, 235, 303
HpyF10VI GCNNNNNNNGC 1 cut(s) 322
HpyF3I CTNAG 5 cut(s) 87, 98, 279, 311, 329
Hsp92II CATG 2 cut(s) 208, 235
Ksp22I TGATCA 1 cut(s) 267
Kzo9I GATC 2 cut(s) 94, 267
LpnPI CCDG 7 cut(s) 9, 36, 66, 85, 213, 266, 298
LweI GCATC 1 cut(s) 277
MabI ACCWGGT 1 cut(s) 22
MalI GATC 2 cut(s) 96, 269
MboI GATC 2 cut(s) 94, 267
MboII GAAGA 1 cut(s) 305
MfeI CAATTG 1 cut(s) 336
MhlI GDGCHC 1 cut(s) 280
MluCI AATT 1 cut(s) 336
MlyI GAGTC 1 cut(s) 92
MnlI CCTC 4 cut(s) 26, 29, 102, 132
MseI TTAA 2 cut(s) 225, 361
MslI CAYNNNNRTG 1 cut(s) 249
MspI CCGG 1 cut(s) 200
MspR9I CCNGG 3 cut(s) 24, 200, 201
MunI CAATTG 1 cut(s) 336
MvaI CCWGG 1 cut(s) 24
MwoI GCNNNNNNNGC 1 cut(s) 322
NciI CCSGG 2 cut(s) 200, 201
NdeI CATATG 1 cut(s) 272
NdeII GATC 2 cut(s) 94, 267
NlaIII CATG 2 cut(s) 208, 235
PleI GAGTC 1 cut(s) 91
PpsI GAGTC 1 cut(s) 91
Psp6I CCWGG 1 cut(s) 22
PspGI CCWGG 1 cut(s) 22
PstNI CAGNNNCTG 1 cut(s) 23
RseI CAYNNNNRTG 1 cut(s) 249
SaqAI TTAA 2 cut(s) 225, 361
Sau3AI GATC 2 cut(s) 94, 267
SchI GAGTC 1 cut(s) 92
ScrFI CCNGG 3 cut(s) 24, 200, 201
SduI GDGCHC 1 cut(s) 280
SetI ASST 2 cut(s) 25, 195
SexAI ACCWGGT 1 cut(s) 22
SfaNI GCATC 1 cut(s) 277
SmaI CCCGGG 1 cut(s) 201
SmiMI CAYNNNNRTG 1 cut(s) 249
Sse9I AATT 1 cut(s) 336
SsiI CCGC 2 cut(s) 75, 345
SspI AATATT 1 cut(s) 138
StyD4I CCNGG 3 cut(s) 22, 198, 199
TaaI ACNGT 1 cut(s) 131
TaqI TCGA 1 cut(s) 107
TasI AATT 1 cut(s) 336
Tru1I TTAA 2 cut(s) 225, 361
Tru9I TTAA 2 cut(s) 225, 361
TscAI CASTG 2 cut(s) 267, 305
TspDTI ATGAA 1 cut(s) 203
TspMI CCCGGG 1 cut(s) 199
TspRI CASTG 2 cut(s) 267, 305
XagI CCTNNNNNAGG 1 cut(s) 27
XmaI CCCGGG 1 cut(s) 199
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.