Rh7BG069500

ATP-dependent Clp protease adapter protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0004724
Physical Location & Seq
Forward (+)
4627185 .. 4628464
1280 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG069500.1

Sequence Viewer

Length: 363 bp
ATGACTGCAACAACCACTGTGCTTGGAAAAGGAGGTGGGTTGTTGGAGAAGCCAACCATAGAGAAGACCACACCTGGTCGTGATTCTGAGTTTGACTTGAGGAAATCAAAGAAAATGTCCCCACCTTATCGTGTGATGCTGCATAATGATAACTTTAACAAGCGGGAGTATGTTGTCCAAGTTCTGATGAAGGTTATCCCCGGAATGACCGTTGACATTGCAGTCAACGTGATGCAGGAGGCACATCACAACGGCCTGGCAGTGGTGATTGTGTGTGCTCAGGTGGATGCAGAAGACCACTGCATGCAGCTCAGAGGCAATGGTCTTCTGAGTTCGGTTGAGCCTGCAAGTGATGGATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
ClpS

Protein Analysis

120

Amino Acids

13.08

Weight (kDa)

6.4

Isoelectric Point (pI)

37.62

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ClpS PF02617 40 - 106 1.5e-17 ATP-dependent Clp protease adaptor protein ClpS
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 221
AciI CCGC 1 cut(s) 163
AfiI CCNNNNNNNGG 1 cut(s) 262
AjnI CCWGG 2 cut(s) 73, 255
AluBI AGCT 1 cut(s) 310
AluI AGCT 1 cut(s) 310
Alw21I GWGCWC 1 cut(s) 280
AoxI GGCC 1 cut(s) 253
ApeKI GCWGC 2 cut(s) 139, 307
ArsI GACNNNNNNTTYG 2 cut(s) 101, 133
AsuC2I CCSGG 1 cut(s) 201
AsuHPI GGTGA 1 cut(s) 277
BbsI GAAGAC 3 cut(s) 71, 300, 317
Bbv12I GWGCWC 1 cut(s) 280
BbvI GCAGC 2 cut(s) 126, 319
BccI CCATC 1 cut(s) 347
BceAI ACGGC 1 cut(s) 268
BciT130I CCWGG 2 cut(s) 75, 257
BcnI CCSGG 1 cut(s) 201
BisI GCNGC 2 cut(s) 140, 308
BlsI GCNGC 2 cut(s) 141, 309
Bme1390I CCNGG 3 cut(s) 75, 201, 257
BmrFI CCNGG 3 cut(s) 75, 201, 257
BmsI GCATC 3 cut(s) 126, 222, 277
BpiI GAAGAC 3 cut(s) 71, 300, 317
Bpu10I CCTNAGC 1 cut(s) 279
BpuEI CTTGAG 1 cut(s) 118
BpuMI CCSGG 1 cut(s) 201
BsaJI CCNNGG 1 cut(s) 199
Bsc4I CCNNNNNNNGG 1 cut(s) 262
Bse3DI GCAATG 2 cut(s) 216, 325
BseBI CCWGG 2 cut(s) 75, 257
BseDI CCNNGG 1 cut(s) 199
BseGI GGATG 2 cut(s) 292, 362
BseLI CCNNNNNNNGG 1 cut(s) 262
BseMI GCAATG 2 cut(s) 216, 325
BseMII CTCAG 4 cut(s) 78, 293, 320, 325
BseXI GCAGC 2 cut(s) 126, 319
BshFI GGCC 1 cut(s) 255
BsiHKAI GWGCWC 1 cut(s) 280
BsiSI CCGG 1 cut(s) 201
BslFI GGGAC 1 cut(s) 103
BslI CCNNNNNNNGG 1 cut(s) 262
BsmFI GGGAC 1 cut(s) 103
BsnI GGCC 1 cut(s) 255
Bsp1286I GDGCHC 1 cut(s) 280
BspACI CCGC 1 cut(s) 163
BspANI GGCC 1 cut(s) 255
BspCNI CTCAG 4 cut(s) 79, 292, 321, 324
BsrDI GCAATG 2 cut(s) 216, 325
BssECI CCNNGG 1 cut(s) 199
Bst2UI CCWGG 2 cut(s) 75, 257
Bst4CI ACNGT 2 cut(s) 19, 211
BstC8I GCNNGC 2 cut(s) 305, 345
BstDEI CTNAG 4 cut(s) 87, 279, 311, 329
BstF5I GGATG 2 cut(s) 292, 362
BstNI CCWGG 2 cut(s) 75, 257
BstNSI RCATGY 1 cut(s) 307
BstSCI CCNGG 3 cut(s) 73, 199, 255
BstV1I GCAGC 2 cut(s) 126, 319
BstV2I GAAGAC 3 cut(s) 71, 300, 317
BsuRI GGCC 1 cut(s) 255
BtsCI GGATG 2 cut(s) 292, 362
BtsI GCAGTG 2 cut(s) 267, 298
BtsIMutI CAGTG 3 cut(s) 15, 267, 298
Cac8I GCNNGC 2 cut(s) 305, 345
CsiI ACCWGGT 1 cut(s) 73
CspCI CAANNNNNGTGG 2 cut(s) 4, 39
CviAII CATG 1 cut(s) 304
CviJI RGCY 4 cut(s) 52, 255, 310, 343
CviKI_1 RGCY 4 cut(s) 52, 255, 310, 343
DdeI CTNAG 4 cut(s) 87, 279, 311, 329
DrdI GACNNNNNNGTC 1 cut(s) 221
DseDI GACNNNNNNGTC 1 cut(s) 221
EcoRII CCWGG 2 cut(s) 73, 255
FaeI CATG 1 cut(s) 307
FaiI YATR 4 cut(s) 59, 144, 171, 305
FaqI GGGAC 1 cut(s) 103
FatI CATG 1 cut(s) 303
FauI CCCGC 1 cut(s) 156
Fnu4HI GCNGC 2 cut(s) 140, 308
FokI GGATG 1 cut(s) 299
Fsp4HI GCNGC 2 cut(s) 140, 308
GluI GCNGC 2 cut(s) 140, 308
HaeIII GGCC 1 cut(s) 255
HapII CCGG 1 cut(s) 201
Hin1II CATG 1 cut(s) 307
HincII GTYRAC 2 cut(s) 214, 226
HindII GTYRAC 2 cut(s) 214, 226
HinfI GANTC 1 cut(s) 83
HpaII CCGG 1 cut(s) 201
HphI GGTGA 1 cut(s) 277
Hpy166II GTNNAC 2 cut(s) 214, 226
Hpy188I TCNGA 4 cut(s) 88, 186, 314, 330
Hpy188III TCNNGA 1 cut(s) 80
Hpy8I GTNNAC 2 cut(s) 214, 226
HpyAV CCTTC 1 cut(s) 184
HpyCH4III ACNGT 2 cut(s) 19, 211
HpyCH4IV ACGT 1 cut(s) 228
HpyCH4V TGCA 8 cut(s) 8, 142, 221, 235, 290, 303, 307, 347
HpyF3I CTNAG 4 cut(s) 87, 279, 311, 329
HpySE526I ACGT 1 cut(s) 228
Hsp92II CATG 1 cut(s) 307
LpnPI CCDG 8 cut(s) 60, 87, 214, 221, 242, 266, 269, 357
Lsp1109I GCAGC 2 cut(s) 126, 319
LweI GCATC 3 cut(s) 126, 222, 277
MabI ACCWGGT 1 cut(s) 73
MaeII ACGT 1 cut(s) 228
MboII GAAGA 3 cut(s) 76, 305, 317
MhlI GDGCHC 1 cut(s) 280
MmeI TCCRAC 1 cut(s) 24
MnlI CCTC 4 cut(s) 26, 93, 232, 308
MseI TTAA 1 cut(s) 156
MspI CCGG 1 cut(s) 201
MspR9I CCNGG 3 cut(s) 75, 201, 257
MvaI CCWGG 2 cut(s) 75, 257
NciI CCSGG 1 cut(s) 201
NlaIII CATG 1 cut(s) 307
NspI RCATGY 1 cut(s) 307
PaeI GCATGC 1 cut(s) 307
PfeI GAWTC 1 cut(s) 83
PkrI GCNGC 2 cut(s) 141, 309
Psp6I CCWGG 2 cut(s) 73, 255
PspGI CCWGG 2 cut(s) 73, 255
SaqAI TTAA 1 cut(s) 156
SatI GCNGC 2 cut(s) 140, 308
ScrFI CCNGG 3 cut(s) 75, 201, 257
SduI GDGCHC 1 cut(s) 280
SetI ASST 7 cut(s) 37, 76, 127, 195, 231, 285, 312
SexAI ACCWGGT 1 cut(s) 73
SfaNI GCATC 3 cut(s) 126, 222, 277
SmlI CTYRAG 1 cut(s) 97
SmoI CTYRAG 1 cut(s) 97
SphI GCATGC 1 cut(s) 307
SsiI CCGC 1 cut(s) 163
StyD4I CCNGG 3 cut(s) 73, 199, 255
TaaI ACNGT 2 cut(s) 19, 211
TaiI ACGT 1 cut(s) 231
TfiI GAWTC 1 cut(s) 83
Tru1I TTAA 1 cut(s) 156
Tru9I TTAA 1 cut(s) 156
TscAI CASTG 3 cut(s) 22, 267, 305
TseI GCWGC 2 cut(s) 139, 307
TspDTI ATGAA 1 cut(s) 203
TspRI CASTG 3 cut(s) 22, 267, 305
XceI RCATGY 1 cut(s) 307
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.