Rmu_sc0000051.1_g000009

ATP-dependent Clp protease adapter protein

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0000051.1
Physical Location & Seq
Reverse (-)
29946 .. 30580
635 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0000051.1_g000009.1.cds

Sequence Viewer

Length: 363 bp
atggctgtatcaacagcagcacctggtaaaggaggaggattgttagaaaggcctgttatagagaaaaccactcccgctcgtgagtctgagttcgatctcaggaaatcgaggcaaatatctcctccataccgtgtgatattgcacaatgacaacttcaataaacaggaatatgtagtccaagtgctgatgaaggtcatcctgggcatgacccttgacaatgctgttaatatcatgcaagaagcacaccacaatggcttgtcagtggtgatcatatgtgctcaggctgatgccgaagaacactgcacgcaacttaggcacaatgggtttctgagtttaattgaacccgcaagtgggggatgttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

120

Amino Acids

13.14

Weight (kDa)

6.18

Isoelectric Point (pI)

62.43

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 77
AciI CCGC 2 cut(s) 75, 345
AfiI CCNNNNNNNGG 3 cut(s) 29, 350, 351
AgsI TTSAA 2 cut(s) 157, 341
AjnI CCWGG 2 cut(s) 22, 198
Alw21I GWGCWC 1 cut(s) 280
AlwNI CAGNNNCTG 1 cut(s) 23
AoxI GGCC 1 cut(s) 50
ApeKI GCWGC 1 cut(s) 17
AsuHPI GGTGA 1 cut(s) 277
BauI CACGAG 1 cut(s) 78
Bbv12I GWGCWC 1 cut(s) 280
BbvI GCAGC 1 cut(s) 29
BciT130I CCWGG 2 cut(s) 24, 200
BclI TGATCA 1 cut(s) 267
BisI GCNGC 1 cut(s) 18
BlsI GCNGC 1 cut(s) 19
Bme1390I CCNGG 2 cut(s) 24, 200
BmrFI CCNGG 2 cut(s) 24, 200
BmsI GCATC 1 cut(s) 277
Bpu10I CCTNAGC 1 cut(s) 279
BsaJI CCNNGG 1 cut(s) 199
Bsc4I CCNNNNNNNGG 3 cut(s) 29, 350, 351
BseBI CCWGG 2 cut(s) 24, 200
BseDI CCNNGG 1 cut(s) 199
BseGI GGATG 2 cut(s) 195, 362
BseLI CCNNNNNNNGG 3 cut(s) 29, 350, 351
BseMII CTCAG 4 cut(s) 78, 112, 293, 320
BseRI GAGGAG 2 cut(s) 48, 111
BseXI GCAGC 1 cut(s) 29
BsgI GTGCAG 1 cut(s) 286
BshFI GGCC 1 cut(s) 52
BsiHKAI GWGCWC 1 cut(s) 280
BslI CCNNNNNNNGG 3 cut(s) 29, 350, 351
BsnI GGCC 1 cut(s) 52
Bsp1286I GDGCHC 1 cut(s) 280
Bsp143I GATC 2 cut(s) 94, 267
BspACI CCGC 2 cut(s) 75, 345
BspANI GGCC 1 cut(s) 52
BspCNI CTCAG 4 cut(s) 79, 111, 292, 321
BsrBI CCGCTC 1 cut(s) 77
BssECI CCNNGG 1 cut(s) 199
BssMI GATC 2 cut(s) 94, 267
BssSI CACGAG 1 cut(s) 78
Bst2BI CACGAG 1 cut(s) 78
Bst2UI CCWGG 2 cut(s) 24, 200
Bst4CI ACNGT 1 cut(s) 131
BstC8I GCNNGC 1 cut(s) 305
BstDEI CTNAG 5 cut(s) 87, 98, 279, 311, 329
BstENI CCTNNNNNAGG 1 cut(s) 27
BstF5I GGATG 2 cut(s) 195, 362
BstKTI GATC 2 cut(s) 97, 270
BstMBI GATC 2 cut(s) 94, 267
BstMWI GCNNNNNNNGC 1 cut(s) 313
BstNI CCWGG 2 cut(s) 24, 200
BstSCI CCNGG 2 cut(s) 22, 198
BstV1I GCAGC 1 cut(s) 29
BsuRI GGCC 1 cut(s) 52
BtsCI GGATG 2 cut(s) 195, 362
BtsI GCAGTG 1 cut(s) 298
BtsIMutI CAGTG 2 cut(s) 267, 298
Cac8I GCNNGC 1 cut(s) 305
CaiI CAGNNNCTG 1 cut(s) 23
CsiI ACCWGGT 1 cut(s) 22
CviAII CATG 2 cut(s) 205, 232
CviJI RGCY 4 cut(s) 5, 52, 255, 284
CviKI_1 RGCY 4 cut(s) 5, 52, 255, 284
DdeI CTNAG 5 cut(s) 87, 98, 279, 311, 329
DpnI GATC 2 cut(s) 96, 269
DpnII GATC 2 cut(s) 94, 267
Eco147I AGGCCT 1 cut(s) 52
EcoNI CCTNNNNNAGG 1 cut(s) 27
EcoRII CCWGG 2 cut(s) 22, 198
FaeI CATG 2 cut(s) 208, 235
FaiI YATR 7 cut(s) 59, 127, 171, 206, 233, 272, 274
FatI CATG 2 cut(s) 204, 231
FauI CCCGC 2 cut(s) 82, 352
FauNDI CATATG 1 cut(s) 272
FbaI TGATCA 1 cut(s) 267
Fnu4HI GCNGC 1 cut(s) 18
FokI GGATG 1 cut(s) 182
Fsp4HI GCNGC 1 cut(s) 18
GluI GCNGC 1 cut(s) 18
HaeIII GGCC 1 cut(s) 52
Hin1II CATG 2 cut(s) 208, 235
HinfI GANTC 1 cut(s) 83
HphI GGTGA 1 cut(s) 277
Hpy188I TCNGA 2 cut(s) 88, 330
Hpy188III TCNNGA 2 cut(s) 80, 100
HpyAV CCTTC 1 cut(s) 184
HpyCH4III ACNGT 1 cut(s) 131
HpyCH4V TGCA 3 cut(s) 142, 235, 303
HpyF10VI GCNNNNNNNGC 1 cut(s) 313
HpyF3I CTNAG 5 cut(s) 87, 98, 279, 311, 329
Hsp92II CATG 2 cut(s) 208, 235
Ksp22I TGATCA 1 cut(s) 267
Kzo9I GATC 2 cut(s) 94, 267
LpnPI CCDG 8 cut(s) 9, 36, 66, 85, 149, 185, 212, 266
Lsp1109I GCAGC 1 cut(s) 29
LweI GCATC 1 cut(s) 277
MabI ACCWGGT 1 cut(s) 22
MalI GATC 2 cut(s) 96, 269
MbiI CCGCTC 1 cut(s) 77
MboI GATC 2 cut(s) 94, 267
MboII GAAGA 1 cut(s) 305
MhlI GDGCHC 1 cut(s) 280
MluCI AATT 1 cut(s) 336
MlyI GAGTC 1 cut(s) 92
MnlI CCTC 4 cut(s) 26, 29, 102, 132
MseI TTAA 3 cut(s) 225, 335, 361
MslI CAYNNNNRTG 1 cut(s) 249
MspR9I CCNGG 2 cut(s) 24, 200
MvaI CCWGG 2 cut(s) 24, 200
MwoI GCNNNNNNNGC 1 cut(s) 313
NdeI CATATG 1 cut(s) 272
NdeII GATC 2 cut(s) 94, 267
NlaIII CATG 2 cut(s) 208, 235
PceI AGGCCT 1 cut(s) 52
PkrI GCNGC 1 cut(s) 19
PleI GAGTC 1 cut(s) 91
PpsI GAGTC 1 cut(s) 91
Psp6I CCWGG 2 cut(s) 22, 198
PspGI CCWGG 2 cut(s) 22, 198
PstNI CAGNNNCTG 1 cut(s) 23
RseI CAYNNNNRTG 1 cut(s) 249
SaqAI TTAA 3 cut(s) 225, 335, 361
SatI GCNGC 1 cut(s) 18
Sau3AI GATC 2 cut(s) 94, 267
SchI GAGTC 1 cut(s) 92
ScrFI CCNGG 2 cut(s) 24, 200
SduI GDGCHC 1 cut(s) 280
SetI ASST 2 cut(s) 25, 195
SexAI ACCWGGT 1 cut(s) 22
SfaNI GCATC 1 cut(s) 277
SmiMI CAYNNNNRTG 1 cut(s) 249
Sse9I AATT 1 cut(s) 336
SseBI AGGCCT 1 cut(s) 52
SsiI CCGC 2 cut(s) 75, 345
StuI AGGCCT 1 cut(s) 52
StyD4I CCNGG 2 cut(s) 22, 198
TaaI ACNGT 1 cut(s) 131
TaqI TCGA 2 cut(s) 93, 107
TasI AATT 1 cut(s) 336
Tru1I TTAA 3 cut(s) 225, 335, 361
Tru9I TTAA 3 cut(s) 225, 335, 361
TscAI CASTG 2 cut(s) 267, 305
TseI GCWGC 1 cut(s) 17
TspDTI ATGAA 1 cut(s) 203
TspRI CASTG 2 cut(s) 267, 305
XagI CCTNNNNNAGG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.