Basic Information

Type: gene

Biological Identity

Species

rosa_laevigata

Chromosome

Chr3

Orthogroup ID

OG0009652

Physical Location & Seq

Genomic Coordinates Reverse (-)

37843767 .. 37844306

Gene Structure 540 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

RLM00000013739

Sequence Viewer

CDS Protein Promoter (2k)

Length: 540 bp

ATGGCACGATCTGTTGTGGTGTTCCTAATGGCTGCACTCTTGGTAGCCTCCACAAATGCACAATCTCCATCATCATCACCAGCTGCATCCCCGAATGCGGGTGCTAAAGCACCTAATGCGGCTGCTACCGCACCTACACCATCAATAACTCCTACGCCTACTGTTTCACCTTCTTCATCGAAGACAGCTCCTGCGGCTACTCCTTCTCAAGCGAAGACTACACCAGAGGCTGCTCCAACTGCTTCTAAGACTTCACCACAAGCTGCCCCTACTTCTTCCAAGACTTCACCACAAGCTGCTCCAATAACTTCCCCAAGTTCGTCAGATGCTACTCCTTCTACCGCACCCATTGCTAGCTCTCCACCATCTCCTCCACCCCCTACCTCTGAATCTCAGGCAGTTCCTCCTACTACAGACTTTGTACCAACTGATGGGGCAGGTGGGGCACCTTCCCCATCCAACAATGGTATCGTTTTGAACAAGATCAACGTAGCTGCCTCGGTTGCCCTTGGAGTTGTTGCAGCTGTCTTGGTTATGTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

180

Amino Acids

17.04

Weight (kDa)

9.3

Isoelectric Point (pI)

81.86

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009652)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_2g11830
prunus_persica	Prupe.3G034100_v2.0.a1 Prupe.3G034300_v2.0.a1 Prupe.6G147700_v2.0.a1 Prupe.8G065400_v2.0.a1 Prupe.8G065500_v2.0.a1 Prupe.8G065600_v2.0.a1 Prupe.8G065700_v2.0.a1 Prupe.8G065800_v2.0.a1 Prupe.8G066000_v2.0.a1 Prupe.8G066100_v2.0.a1 Prupe.8G066200_v2.0.a1
rosa_chinensis	RchiOBHm_Chr6g0271461
rosa_laevigata	RLG00000013739
rosa_multiflora	Rmu_sc0001679.1_g000013
rosa_roxburghii	Rroxscaffold_7G00197000
rosa_rugosa	Rorug06G0060900.1
rosa_samantha	Rh6AG180200 Rh6BG183300 Rh6CG180000 Rh6DG171900
rosa_wichuraiana	Rw6G015470

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AarI	CACCTGC	1 cut(s)	428
Acc36I	ACCTGC	1 cut(s)	428
AccB1I	GGYRCC	1 cut(s)	445
AccB7I	CCANNNNNTGG	1 cut(s)	431
AciI	CCGC	5 cut(s)	98, 119, 129, 194, 342
AfaI	GTAC	1 cut(s)	423
AfiI	CCNNNNNNNGG	3 cut(s)	97, 98, 431
AgsI	TTSAA	1 cut(s)	478
AluBI	AGCT	7 cut(s)	83, 188, 263, 296, 357, 494, 524
AluI	AGCT	7 cut(s)	83, 188, 263, 296, 357, 494, 524
AlwNI	CAGNNNCTG	2 cut(s)	191, 230
ApeKI	GCWGC	8 cut(s)	32, 83, 122, 230, 263, 296, 494, 521
AsuHPI	GGTGA	4 cut(s)	69, 159, 246, 279
AsuNHI	GCTAGC	1 cut(s)	353
BaeGI	GKGCMC	1 cut(s)	448
BaeI	ACNNNNGTAYC	2 cut(s)	451, 484
BanI	GGYRCC	1 cut(s)	445
BbsI	GAAGAC	2 cut(s)	188, 221
BbvI	GCAGC	8 cut(s)	19, 70, 109, 217, 250, 283, 481, 533
BccI	CCATC	5 cut(s)	76, 148, 373, 425, 463
BfaI	CTAG	1 cut(s)	354
BfmI	CTRYAG	1 cut(s)	411
BfuAI	ACCTGC	1 cut(s)	428
BmiI	GGNNCC	1 cut(s)	447
BmsI	GCATC	2 cut(s)	95, 316
BmtI	GCTAGC	1 cut(s)	357
BpiI	GAAGAC	2 cut(s)	188, 221
BpuEI	CTTGAG	1 cut(s)	192
BsaJI	CCNNGG	2 cut(s)	498, 508
Bsc4I	CCNNNNNNNGG	3 cut(s)	97, 98, 431
Bse3DI	GCAATG	1 cut(s)	348
BseDI	CCNNGG	2 cut(s)	498, 508
BseGI	GGATG	2 cut(s)	86, 455
BseLI	CCNNNNNNNGG	3 cut(s)	97, 98, 431
BseMI	GCAATG	1 cut(s)	348
BseMII	CTCAG	1 cut(s)	407
BseRI	GAGGAG	1 cut(s)	360
BseSI	GKGCMC	1 cut(s)	448
BseXI	GCAGC	8 cut(s)	19, 70, 109, 217, 250, 283, 481, 533
BsgI	GTGCAG	1 cut(s)	18
BshNI	GGYRCC	1 cut(s)	445
BslI	CCNNNNNNNGG	3 cut(s)	97, 98, 431
BsmI	GAATGC	1 cut(s)	100
Bsp1286I	GDGCHC	1 cut(s)	448
Bsp143I	GATC	2 cut(s)	8, 483
BspACI	CCGC	5 cut(s)	98, 119, 129, 194, 342
BspCNI	CTCAG	1 cut(s)	406
BspLI	GGNNCC	1 cut(s)	447
BspMI	ACCTGC	1 cut(s)	428
BspOI	GCTAGC	1 cut(s)	357
BspT107I	GGYRCC	1 cut(s)	445
BsrDI	GCAATG	1 cut(s)	348
BssECI	CCNNGG	2 cut(s)	498, 508
BssMI	GATC	2 cut(s)	8, 483
BssT1I	CCWWGG	1 cut(s)	508
Bst4CI	ACNGT	1 cut(s)	163
BstAPI	GCANNNNNTGC	2 cut(s)	116, 350
BstC8I	GCNNGC	1 cut(s)	355
BstDEI	CTNAG	2 cut(s)	246, 393
BstF5I	GGATG	2 cut(s)	86, 455
BstKTI	GATC	2 cut(s)	11, 486
BstMBI	GATC	2 cut(s)	8, 483
BstMWI	GCNNNNNNNGC	7 cut(s)	116, 128, 194, 239, 350, 443, 503
BstSFI	CTRYAG	1 cut(s)	411
BstSLI	GKGCMC	1 cut(s)	448
BstV1I	GCAGC	8 cut(s)	19, 70, 109, 217, 250, 283, 481, 533
BstV2I	GAAGAC	2 cut(s)	188, 221
BtsCI	GGATG	2 cut(s)	86, 455
BveI	ACCTGC	1 cut(s)	428
Cac8I	GCNNGC	1 cut(s)	355
CaiI	CAGNNNCTG	2 cut(s)	191, 230
Csp6I	GTAC	1 cut(s)	422
CviQI	GTAC	1 cut(s)	422
DdeI	CTNAG	2 cut(s)	246, 393
DpnI	GATC	2 cut(s)	10, 485
DpnII	GATC	2 cut(s)	8, 483
Eco130I	CCWWGG	1 cut(s)	508
EcoT14I	CCWWGG	1 cut(s)	508
ErhI	CCWWGG	1 cut(s)	508
FaiI	YATR	1 cut(s)	536
FauI	CCCGC	1 cut(s)	91
FokI	GGATG	2 cut(s)	73, 442
FspBI	CTAG	1 cut(s)	354
HinfI	GANTC	1 cut(s)	389
HphI	GGTGA	4 cut(s)	69, 159, 246, 279
Hpy188I	TCNGA	2 cut(s)	325, 388
HpyAV	CCTTC	4 cut(s)	180, 213, 345, 459
HpyCH4III	ACNGT	1 cut(s)	163
HpyCH4IV	ACGT	1 cut(s)	489
HpyCH4V	TGCA	4 cut(s)	35, 59, 86, 521
HpyF10VI	GCNNNNNNNGC	7 cut(s)	116, 128, 194, 239, 350, 443, 503
HpyF3I	CTNAG	2 cut(s)	246, 393
HpySE526I	ACGT	1 cut(s)	489
Kzo9I	GATC	2 cut(s)	8, 483
LmnI	GCTCC	3 cut(s)	193, 238, 304
LpnPI	CCDG	5 cut(s)	93, 204, 237, 380, 423
Lsp1109I	GCAGC	8 cut(s)	19, 70, 109, 217, 250, 283, 481, 533
LweI	GCATC	2 cut(s)	95, 316
MaeI	CTAG	1 cut(s)	354
MaeII	ACGT	1 cut(s)	489
MalI	GATC	2 cut(s)	10, 485
MboI	GATC	2 cut(s)	8, 483
MboII	GAAGA	4 cut(s)	165, 193, 226, 267
MhlI	GDGCHC	1 cut(s)	448
MmeI	TCCRAC	2 cut(s)	260, 483
MnlI	CCTC	6 cut(s)	58, 220, 381, 394, 414, 508
MspA1I	CMGCKG	2 cut(s)	83, 524
Mva1269I	GAATGC	1 cut(s)	100
MwoI	GCNNNNNNNGC	7 cut(s)	116, 128, 194, 239, 350, 443, 503
NdeII	GATC	2 cut(s)	8, 483
NheI	GCTAGC	1 cut(s)	353
NlaIV	GGNNCC	1 cut(s)	447
PaqCI	CACCTGC	1 cut(s)	428
PctI	GAATGC	1 cut(s)	100
PfeI	GAWTC	1 cut(s)	389
PflMI	CCANNNNNTGG	1 cut(s)	431
PspN4I	GGNNCC	1 cut(s)	447
PstNI	CAGNNNCTG	2 cut(s)	191, 230
PvuII	CAGCTG	2 cut(s)	83, 524
RsaI	GTAC	1 cut(s)	423
RsaNI	GTAC	1 cut(s)	422
Sau3AI	GATC	2 cut(s)	8, 483
SduI	GDGCHC	1 cut(s)	448
SfaNI	GCATC	2 cut(s)	95, 316
SfcI	CTRYAG	1 cut(s)	411
SmlI	CTYRAG	1 cut(s)	207
SmoI	CTYRAG	1 cut(s)	207
SsiI	CCGC	5 cut(s)	98, 119, 129, 194, 342
SspMI	CTAG	1 cut(s)	354
StyI	CCWWGG	1 cut(s)	508
TaaI	ACNGT	1 cut(s)	163
TaiI	ACGT	1 cut(s)	492
TaqI	TCGA	1 cut(s)	179
TauI	GCSGC	2 cut(s)	122, 197
TfiI	GAWTC	1 cut(s)	389
TseI	GCWGC	8 cut(s)	32, 83, 122, 230, 263, 296, 494, 521
TspDTI	ATGAA	1 cut(s)	165
Van91I	CCANNNNNTGG	1 cut(s)	431
XspI	CTAG	1 cut(s)	354

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.