RLG00000020843

Transmembrane protein 147-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
OG0005653
Physical Location & Seq
Reverse (-)
69336742 .. 69338083
1342 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000020843

Sequence Viewer

Length: 342 bp
ATGATTAGTAATGTATTAAATCGCCGAACCAATCGACCCGAATCGAAATCCGGGTGTAATCTTTTCTGGTATAAATTTGTCTGGACGGACATCCGAGGAGAAGAAGTATCTGATATTGAAAGCTTCGATCCATATCAGGAATTGTTGAAAGCTTTGATCGGTTTCATAGATGTTGCTGGCCTTTACTTTGCTTTGACCCAGTTGACCCATAGGAACATCTGGTGGGCTTTTGCTGATTCGGTTCTCCATAGATTGGCACCTCTGTGGGTGGGTGCCAGAGGACTAGAATTTACCTGGGATTACATTCTGCAAGGCCTTGAGGATTACATTCCTAACAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF2053

Protein Analysis

114

Amino Acids

13.26

Weight (kDa)

5.02

Isoelectric Point (pI)

35.81

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF2053 PF09767 37 - 108 9e-20 Predicted membrane protein (DUF2053)
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 2 cut(s) 256, 272
AccB7I CCANNNNNTGG 1 cut(s) 253
AclWI GGATC 1 cut(s) 122
AcsI RAATTY 2 cut(s) 74, 287
AfiI CCNNNNNNNGG 1 cut(s) 253
AgsI TTSAA 2 cut(s) 119, 148
AjnI CCWGG 1 cut(s) 293
AleI CACNNNNGTG 1 cut(s) 262
AluBI AGCT 2 cut(s) 123, 152
AluI AGCT 2 cut(s) 123, 152
AlwI GGATC 1 cut(s) 122
AoxI GGCC 2 cut(s) 178, 313
ApoI RAATTY 2 cut(s) 74, 287
AsuC2I CCSGG 1 cut(s) 52
BanI GGYRCC 2 cut(s) 256, 272
BciT130I CCWGG 1 cut(s) 295
BcnI CCSGG 1 cut(s) 52
BfaI CTAG 1 cut(s) 284
Bme1390I CCNGG 2 cut(s) 52, 295
BmiI GGNNCC 2 cut(s) 258, 274
BmrFI CCNGG 2 cut(s) 52, 295
BmrI ACTGGG 1 cut(s) 193
BmuI ACTGGG 1 cut(s) 193
BpuEI CTTGAG 1 cut(s) 338
BpuMI CCSGG 1 cut(s) 52
BsaBI GATNNNNATC 1 cut(s) 132
BsaJI CCNNGG 2 cut(s) 94, 294
BsaXI ACNNNNNCTCC 2 cut(s) 90, 120
Bsc4I CCNNNNNNNGG 1 cut(s) 253
Bse1I ACTGG 1 cut(s) 199
Bse8I GATNNNNATC 1 cut(s) 132
BseBI CCWGG 1 cut(s) 295
BseDI CCNNGG 2 cut(s) 94, 294
BseGI GGATG 1 cut(s) 90
BseJI GATNNNNATC 1 cut(s) 132
BseLI CCNNNNNNNGG 1 cut(s) 253
BseNI ACTGG 1 cut(s) 199
BseRI GAGGAG 1 cut(s) 111
BshFI GGCC 2 cut(s) 180, 315
BshNI GGYRCC 2 cut(s) 256, 272
BsiSI CCGG 1 cut(s) 51
BslI CCNNNNNNNGG 1 cut(s) 253
BsnI GGCC 2 cut(s) 180, 315
Bsp143I GATC 2 cut(s) 127, 156
BspANI GGCC 2 cut(s) 180, 315
BspLI GGNNCC 2 cut(s) 258, 274
BspPI GGATC 1 cut(s) 122
BspT107I GGYRCC 2 cut(s) 256, 272
BsrI ACTGG 1 cut(s) 199
BssECI CCNNGG 2 cut(s) 94, 294
BssMI GATC 2 cut(s) 127, 156
Bst2UI CCWGG 1 cut(s) 295
BstC8I GCNNGC 1 cut(s) 178
BstF5I GGATG 1 cut(s) 90
BstKTI GATC 2 cut(s) 130, 159
BstMBI GATC 2 cut(s) 127, 156
BstNI CCWGG 1 cut(s) 295
BstSCI CCNGG 2 cut(s) 50, 293
BsuRI GGCC 2 cut(s) 180, 315
BtsCI GGATG 1 cut(s) 90
Cac8I GCNNGC 1 cut(s) 178
CviJI RGCY 5 cut(s) 123, 152, 180, 227, 315
CviKI_1 RGCY 5 cut(s) 123, 152, 180, 227, 315
DpnI GATC 2 cut(s) 129, 158
DpnII GATC 2 cut(s) 127, 156
Eco147I AGGCCT 1 cut(s) 315
EcoRII CCWGG 1 cut(s) 293
FaiI YATR 5 cut(s) 72, 133, 167, 210, 249
FokI GGATG 1 cut(s) 77
FspBI CTAG 1 cut(s) 284
HaeIII GGCC 2 cut(s) 180, 315
HapII CCGG 1 cut(s) 51
HincII GTYRAC 1 cut(s) 204
HindII GTYRAC 1 cut(s) 204
HindIII AAGCTT 2 cut(s) 121, 150
HinfI GANTC 2 cut(s) 41, 236
HpaII CCGG 1 cut(s) 51
Hpy166II GTNNAC 1 cut(s) 204
Hpy188I TCNGA 2 cut(s) 95, 112
Hpy188III TCNNGA 2 cut(s) 82, 137
Hpy8I GTNNAC 1 cut(s) 204
HpyCH4V TGCA 1 cut(s) 310
Kzo9I GATC 2 cut(s) 127, 156
MaeI CTAG 1 cut(s) 284
MalI GATC 2 cut(s) 129, 158
MboI GATC 2 cut(s) 127, 156
MboII GAAGA 1 cut(s) 113
MfeI CAATTG 1 cut(s) 337
MluCI AATT 4 cut(s) 74, 140, 287, 337
MnlI CCTC 4 cut(s) 89, 270, 272, 313
MseI TTAA 1 cut(s) 17
MslI CAYNNNNRTG 1 cut(s) 262
MspI CCGG 1 cut(s) 51
MspR9I CCNGG 2 cut(s) 52, 295
MunI CAATTG 1 cut(s) 337
MvaI CCWGG 1 cut(s) 295
NciI CCSGG 1 cut(s) 52
NdeII GATC 2 cut(s) 127, 156
NlaIV GGNNCC 2 cut(s) 258, 274
OliI CACNNNNGTG 1 cut(s) 262
PceI AGGCCT 1 cut(s) 315
PfeI GAWTC 2 cut(s) 41, 236
PflMI CCANNNNNTGG 1 cut(s) 253
Psp6I CCWGG 1 cut(s) 293
PspGI CCWGG 1 cut(s) 293
PspN4I GGNNCC 2 cut(s) 258, 274
RseI CAYNNNNRTG 1 cut(s) 262
SaqAI TTAA 1 cut(s) 17
Sau3AI GATC 2 cut(s) 127, 156
ScrFI CCNGG 2 cut(s) 52, 295
SetI ASST 4 cut(s) 125, 154, 262, 296
SmiMI CAYNNNNRTG 1 cut(s) 262
SmlI CTYRAG 1 cut(s) 317
SmoI CTYRAG 1 cut(s) 317
Sse9I AATT 4 cut(s) 74, 140, 287, 337
SseBI AGGCCT 1 cut(s) 315
SspMI CTAG 1 cut(s) 284
StuI AGGCCT 1 cut(s) 315
StyD4I CCNGG 2 cut(s) 50, 293
TaqI TCGA 3 cut(s) 34, 44, 126
TasI AATT 4 cut(s) 74, 140, 287, 337
TfiI GAWTC 2 cut(s) 41, 236
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
TspDTI ATGAA 1 cut(s) 154
TspGWI ACGGA 1 cut(s) 101
Van91I CCANNNNNTGG 1 cut(s) 253
XapI RAATTY 2 cut(s) 74, 287
XspI CTAG 1 cut(s) 284
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.