Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_sc0015469.1

Orthogroup ID

OG0005653

Physical Location & Seq

Genomic Coordinates Forward (+)

1 .. 3136

Gene Structure 3136 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_sc0015469.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 1572 bp

ggggaaacttgttctgagagagaaactgaggctactgaagaagaatgcgagagttcaaaggagggcctgaagaagaagagaagttggtggaaacagtttataaacaagagcaagaggagaggaggtaaagttgtctcagaggtatcaaaacctgatactgaagtatccaaagaaaacagaatgaagatcaaacagaacagtaagaggtacatggagttttcagcactttgcaccgggcaagaaattcaggctcacaatgggtttatttggacgatgaagtttagtcctgatggccaatacattgcaactggtggtgaagatggggttgtgcgcatttggtgtgttacaccagatgcctcttgtaattaccttatggctcaaggcaacttagatagcaaacttaaaaagatcaagtctggatgtcgagttatttttcctgacaacagttttcgaattgaagagtcacctctccaagagtttcttggccattccagtgatgtgttagacctggcttggtcaaattcaaaccgtctcatttcttcgtccatggataaaactgttcgtctgtgggaagttggttgcagtcagtgcctacatgttttccatcacaatgactatgtaacatgcattcagttcaatcctctcaatcacaattacttcatcagtggatccatagatggaaaggctcgagtttgggggctttctgagaagcgagttgttgactgggctgatgtgcgagatgtcataacagctatttgttatcaaccagatgggaagggttttgcagttggttcccttgcaggcacttgccgcttctatgaagaatcaggaaaagaagctcttcagcttgttgcacagattcatattcattctagaaggaagacctctggcaacaaaatcaccggcatccagttttctgaggaaaatgctcaaagagttatgataacatcagaagactcaaaagtccgtgtgtttgatggggtagatctcattaagaaatacagaggtcttccaaagtcaggaagtcaaatgtcagcttctttcacatccagcgggaaacgtataatctcagttggagaggactcgcgcgtttatttatgggactatgacagctgtagtgttccatcatccaagcatacaaaatctgttcgatcctgcgaacatttctattgcgaaggtgtgtctgttgcaatcccttggtcaggcatgggaacagaagataggaacttagaaactgctagtccacgatattgctcacaaacacatggccgaatagacgctactcctggcagtagagattcagaacgctttttgcttgggaattggttctttctggagggtccctgcagaggctctgcaacttggcccgaggaaaaccttcctcagtgggattcaccagttgcaggagaggaagatgatcagtggcaatacaaagaccaacaccatcaccaccacaataaagctcacaaccacttgacgaaatcagaaacgtgggggcttgtcattgtaactgcgggatgggatggaaaaatcaggacattccataactatggattgccggtcagcttgtag

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005768 GO:0005794 GO:0005802 GO:0005829 GO:0010008 GO:0012505 GO:0016020 GO:0031090 GO:0031410 GO:0031982 GO:0031984 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044431 GO:0044433 GO:0044440 GO:0044444 GO:0044446 GO:0044464 GO:0048471 GO:0097708 GO:0098588 GO:0098791 GO:0098805

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

WD40

Protein Analysis

523

Amino Acids

59.1

Weight (kDa)

7.08

Isoelectric Point (pI)

46.95

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0005653)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G48870 AT1G48870 AT1G48870
fragaria_vesca	FvH4_1g24010 FvH4_1g24010
malus_domestica	MD01G1011600.v1.1 MD15G1338300.v1.1 MD15G1338400.v1.1
prunus_persica	Prupe.6G159500_v2.0.a1
pyrus_communis	pycom01g04160
rosa_chinensis	RchiOBHm_Chr2g0120151
rosa_laevigata	RLG00000018526 RLG00000020843 RLG00000027801 RLG00000035164
rosa_multiflora	Rmu_co8333869.1_g000001 Rmu_co8364489.1_g000001 Rmu_sc0015469.1_g000001
rosa_roxburghii	Rroxscaffold_2G00123670 Rroxscaffold_7G00185390
rosa_rugosa	Rorug02G0227100.1 Rorug02G0227200
rosa_samantha	Rh2AG283800 Rh2BG295100 Rh2CG272500 Rh2DG308800
rosa_wichuraiana	Rw2G022730 Rw5G023580

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AanI	TTATAA	1 cut(s)	101
AasI	GACNNNNNNGTC	1 cut(s)	962
Acc16I	TGCGCA	1 cut(s)	332
AccII	CGCG	2 cut(s)	1087, 1089
AciI	CCGC	3 cut(s)	811, 1053, 1514
AclWI	GGATC	3 cut(s)	663, 676, 1146
AcoI	YGGCCR	3 cut(s)	292, 484, 1267
AcsI	RAATTY	2 cut(s)	243, 520
AcuI	CTGAAG	4 cut(s)	57, 89, 180, 827
AfaI	GTAC	1 cut(s)	209
AfiI	CCNNNNNNNGG	4 cut(s)	1019, 1202, 1349, 1403
AflIII	ACRYGT	1 cut(s)	595
AgsI	TTSAA	4 cut(s)	57, 458, 525, 637
AjnI	CCWGG	2 cut(s)	507, 1285
AluBI	AGCT	7 cut(s)	752, 839, 847, 1037, 1113, 1463, 1566
AluI	AGCT	7 cut(s)	752, 839, 847, 1037, 1113, 1463, 1566
Alw26I	GTCTC	2 cut(s)	139, 536
AlwI	GGATC	3 cut(s)	663, 676, 1146
Ama87I	CYCGRG	2 cut(s)	687, 1367
AoxI	GGCC	5 cut(s)	64, 292, 484, 1267, 1364
ApoI	RAATTY	2 cut(s)	243, 520
Asp700I	GAANNNNTTC	3 cut(s)	840, 1325, 1377
AspLEI	GCGC	2 cut(s)	333, 1089
AspS9I	GGNCC	3 cut(s)	64, 1340, 1365
AsuC2I	CCSGG	1 cut(s)	235
AsuHPI	GGTGA	5 cut(s)	326, 456, 892, 1386, 1439
AsuII	TTCGAA	1 cut(s)	451
AvaI	CYCGRG	2 cut(s)	687, 1367
AvaII	GGWCC	1 cut(s)	1340
BaeI	ACNNNNGTAYC	4 cut(s)	147, 147, 180, 180
BalI	TGGCCA	2 cut(s)	294, 486
BamHI	GGATCC	1 cut(s)	668
BbsI	GAAGAC	3 cut(s)	887, 960, 1001
BciT130I	CCWGG	2 cut(s)	509, 1287
BciVI	GTATCC	1 cut(s)	175
BclI	TGATCA	1 cut(s)	1417
BcnI	CCSGG	1 cut(s)	235
BcoDI	GTCTC	2 cut(s)	139, 536
BfaI	CTAG	2 cut(s)	873, 1239
BfmI	CTRYAG	2 cut(s)	1114, 1345
BfuI	GTATCC	1 cut(s)	175
BglII	AGATCT	1 cut(s)	985
BisI	GCNGC	1 cut(s)	811
BlsI	GCNGC	1 cut(s)	812
Bme1390I	CCNGG	3 cut(s)	235, 509, 1287
Bme18I	GGWCC	1 cut(s)	1340
BmeT110I	CYCGRG	2 cut(s)	687, 1367
BmgT120I	GGNCC	3 cut(s)	64, 1340, 1365
BmiI	GGNNCC	4 cut(s)	670, 793, 1341, 1342
BmrFI	CCNGG	3 cut(s)	235, 509, 1287
BmrI	ACTGGG	1 cut(s)	733
BmsI	GCATC	2 cut(s)	343, 915
BmuI	ACTGGG	1 cut(s)	733
BpiI	GAAGAC	3 cut(s)	887, 960, 1001
BpmI	CTGGAG	1 cut(s)	1355
Bpu14I	TTCGAA	1 cut(s)	451
BpuEI	CTTGAG	1 cut(s)	363
BpuMI	CCSGG	1 cut(s)	235
BsaJI	CCNNGG	3 cut(s)	546, 1196, 1368
BsaXI	ACNNNNNCTCC	4 cut(s)	109, 114, 139, 144
Bsc4I	CCNNNNNNNGG	4 cut(s)	1019, 1202, 1349, 1403
Bse118I	RCCGGY	2 cut(s)	902, 1558
Bse1I	ACTGG	5 cut(s)	313, 492, 728, 910, 1397
Bse3DI	GCAATG	1 cut(s)	300
BseBI	CCWGG	2 cut(s)	509, 1287
BseDI	CCNNGG	3 cut(s)	546, 1196, 1368
BseGI	GGATG	6 cut(s)	425, 906, 1046, 1127, 1523, 1528
BseLI	CCNNNNNNNGG	4 cut(s)	1019, 1202, 1349, 1403
BseMI	GCAATG	1 cut(s)	300
BseMII	CTCAG	7 cut(s)	6, 18, 150, 696, 909, 1083, 1397
BseNI	ACTGG	5 cut(s)	313, 492, 728, 910, 1397
BseRI	GAGGAG	2 cut(s)	130, 135
Bsh1236I	CGCG	2 cut(s)	1087, 1089
BshFI	GGCC	5 cut(s)	66, 294, 486, 1269, 1366
BsiHKCI	CYCGRG	2 cut(s)	687, 1367
BsiSI	CCGG	3 cut(s)	234, 903, 1559
BslFI	GGGAC	2 cut(s)	1115, 1326
BslI	CCNNNNNNNGG	4 cut(s)	1019, 1202, 1349, 1403
BsmAI	GTCTC	2 cut(s)	139, 536
BsmBI	CGTCTC	1 cut(s)	536
BsmFI	GGGAC	2 cut(s)	1115, 1326
BsmI	GAATGC	2 cut(s)	50, 627
BsnI	GGCC	5 cut(s)	66, 294, 486, 1269, 1366
BsoBI	CYCGRG	2 cut(s)	687, 1367
Bsp119I	TTCGAA	1 cut(s)	451
Bsp143I	GATC	6 cut(s)	186, 408, 668, 985, 1151, 1417
Bsp19I	CCATGG	1 cut(s)	546
BspACI	CCGC	3 cut(s)	811, 1053, 1514
BspANI	GGCC	5 cut(s)	66, 294, 486, 1269, 1366
BspCNI	CTCAG	7 cut(s)	7, 19, 149, 697, 910, 1082, 1396
BspFNI	CGCG	2 cut(s)	1087, 1089
BspLI	GGNNCC	4 cut(s)	670, 793, 1341, 1342
BspMAI	CTGCAG	1 cut(s)	1349
BspPI	GGATC	3 cut(s)	663, 676, 1146
BspQI	GCTCTTC	1 cut(s)	846
BspT104I	TTCGAA	1 cut(s)	451
BsrDI	GCAATG	1 cut(s)	300
BsrFI	RCCGGY	2 cut(s)	902, 1558
BsrI	ACTGG	5 cut(s)	313, 492, 728, 910, 1397
BssAI	RCCGGY	2 cut(s)	902, 1558
BssECI	CCNNGG	3 cut(s)	546, 1196, 1368
BssMI	GATC	6 cut(s)	186, 408, 668, 985, 1151, 1417
BssT1I	CCWWGG	2 cut(s)	546, 1196
Bst2UI	CCWGG	2 cut(s)	509, 1287
Bst4CI	ACNGT	5 cut(s)	96, 200, 446, 530, 559
Bst6I	CTCTTC	3 cut(s)	71, 453, 846
BstAPI	GCANNNNNTGC	1 cut(s)	588
BstBI	TTCGAA	1 cut(s)	451
BstC8I	GCNNGC	1 cut(s)	802
BstDEI	CTNAG	9 cut(s)	15, 27, 136, 388, 705, 918, 1069, 1228, 1383
BstDSI	CCRYGG	1 cut(s)	546
BstENI	CCTNNNNNAGG	1 cut(s)	1200
BstF5I	GGATG	6 cut(s)	425, 906, 1046, 1127, 1523, 1528
BstFNI	CGCG	2 cut(s)	1087, 1089
BstHHI	GCGC	2 cut(s)	333, 1089
BstKTI	GATC	6 cut(s)	189, 411, 671, 988, 1154, 1420
BstMAI	GTCTC	2 cut(s)	139, 536
BstMBI	GATC	6 cut(s)	186, 408, 668, 985, 1151, 1417
BstMWI	GCNNNNNNNGC	2 cut(s)	588, 810
BstNI	CCWGG	2 cut(s)	509, 1287
BstNSI	RCATGY	2 cut(s)	599, 627
BstSCI	CCNGG	3 cut(s)	233, 507, 1285
BstSFI	CTRYAG	2 cut(s)	1114, 1345
BstUI	CGCG	2 cut(s)	1087, 1089
BstV2I	GAAGAC	3 cut(s)	887, 960, 1001
BstX2I	RGATCY	2 cut(s)	668, 985
BstXI	CCANNNNNNTGG	1 cut(s)	1550
BstYI	RGATCY	2 cut(s)	668, 985
BsuI	GTATCC	1 cut(s)	175
BsuRI	GGCC	5 cut(s)	66, 294, 486, 1269, 1366
BtgI	CCRYGG	1 cut(s)	546
BtsCI	GGATG	6 cut(s)	425, 906, 1046, 1127, 1523, 1528
BtsIMutI	CAGTG	5 cut(s)	499, 593, 670, 1391, 1427
Cac8I	GCNNGC	1 cut(s)	802
CfoI	GCGC	2 cut(s)	333, 1089
Cfr10I	RCCGGY	2 cut(s)	902, 1558
Cfr13I	GGNCC	3 cut(s)	64, 1340, 1365
CseI	GACGC	1 cut(s)	1286
Csp6I	GTAC	1 cut(s)	208
CviAII	CATG	6 cut(s)	211, 547, 596, 624, 1207, 1265
CviQI	GTAC	1 cut(s)	208
DdeI	CTNAG	9 cut(s)	15, 27, 136, 388, 705, 918, 1069, 1228, 1383
DpnI	GATC	6 cut(s)	188, 410, 670, 987, 1153, 1419
DpnII	GATC	6 cut(s)	186, 408, 668, 985, 1151, 1417
DrdI	GACNNNNNNGTC	1 cut(s)	962
DseDI	GACNNNNNNGTC	1 cut(s)	962
EaeI	YGGCCR	3 cut(s)	292, 484, 1267
Eam1104I	CTCTTC	3 cut(s)	71, 453, 846
EarI	CTCTTC	3 cut(s)	71, 453, 846
Eco130I	CCWWGG	2 cut(s)	546, 1196
Eco47I	GGWCC	1 cut(s)	1340
Eco57I	CTGAAG	4 cut(s)	57, 89, 180, 827
Eco88I	CYCGRG	2 cut(s)	687, 1367
EcoNI	CCTNNNNNAGG	1 cut(s)	1200
EcoO109I	RGGNCCY	2 cut(s)	64, 1340
EcoRII	CCWGG	2 cut(s)	507, 1285
EcoT14I	CCWWGG	2 cut(s)	546, 1196
EcoT22I	ATGCAT	1 cut(s)	629
ErhI	CCWWGG	2 cut(s)	546, 1196
Esp3I	CGTCTC	1 cut(s)	536
FaeI	CATG	6 cut(s)	214, 550, 599, 627, 1210, 1268
FalI	AAGNNNNNCTT	4 cut(s)	465, 497, 825, 857
FaqI	GGGAC	2 cut(s)	1115, 1326
FatI	CATG	6 cut(s)	210, 546, 595, 623, 1206, 1264
FauI	CCCGC	2 cut(s)	1046, 1507
FbaI	TGATCA	1 cut(s)	1417
Fnu4HI	GCNGC	1 cut(s)	811
FokI	GGATG	6 cut(s)	432, 893, 1033, 1114, 1530, 1535
Fsp4HI	GCNGC	1 cut(s)	811
FspAI	RTGCGCAY	1 cut(s)	332
FspBI	CTAG	2 cut(s)	873, 1239
FspI	TGCGCA	1 cut(s)	332
GlaI	GCGC	2 cut(s)	332, 1088
GluI	GCNGC	1 cut(s)	811
GsuI	CTGGAG	1 cut(s)	1355
HaeIII	GGCC	5 cut(s)	66, 294, 486, 1269, 1366
HapII	CCGG	3 cut(s)	234, 903, 1559
HgaI	GACGC	1 cut(s)	1286
HhaI	GCGC	2 cut(s)	333, 1089
Hin1II	CATG	6 cut(s)	214, 550, 599, 627, 1210, 1268
Hin6I	GCGC	2 cut(s)	331, 1087
HinP1I	GCGC	2 cut(s)	331, 1087
HincII	GTYRAC	1 cut(s)	721
HindII	GTYRAC	1 cut(s)	721
HinfI	GANTC	7 cut(s)	461, 824, 859, 956, 1082, 1298, 1391
HpaII	CCGG	3 cut(s)	234, 903, 1559
HphI	GGTGA	5 cut(s)	326, 456, 892, 1386, 1439
Hpy166II	GTNNAC	2 cut(s)	721, 1244
Hpy188I	TCNGA	7 cut(s)	16, 139, 706, 919, 952, 1303, 1486
Hpy188III	TCNNGA	8 cut(s)	287, 417, 437, 828, 873, 1020, 1334, 1534
Hpy8I	GTNNAC	2 cut(s)	721, 1244
HpyAV	CCTTC	4 cut(s)	769, 870, 1169, 1388
HpyCH4III	ACNGT	5 cut(s)	96, 200, 446, 530, 559
HpyCH4IV	ACGT	2 cut(s)	1060, 1490
HpyF10VI	GCNNNNNNNGC	2 cut(s)	588, 810
HpyF3I	CTNAG	9 cut(s)	15, 27, 136, 388, 705, 918, 1069, 1228, 1383
HpySE526I	ACGT	2 cut(s)	1060, 1490
Hsp92II	CATG	6 cut(s)	214, 550, 599, 627, 1210, 1268
HspAI	GCGC	2 cut(s)	331, 1087
KflI	GGGWCCC	1 cut(s)	1340
Ksp22I	TGATCA	1 cut(s)	1417
Kzo9I	GATC	6 cut(s)	186, 408, 668, 985, 1151, 1417
LguI	GCTCTTC	1 cut(s)	846
LweI	GCATC	2 cut(s)	343, 915
MaeI	CTAG	2 cut(s)	873, 1239
MaeII	ACGT	2 cut(s)	1060, 1490
MaeIII	GTNAC	4 cut(s)	343, 462, 619, 1507
MalI	GATC	6 cut(s)	188, 410, 670, 987, 1153, 1419
MboI	GATC	6 cut(s)	186, 408, 668, 985, 1151, 1417
MflI	RGATCY	2 cut(s)	668, 985
MlsI	TGGCCA	2 cut(s)	294, 486
MluCI	AATT	6 cut(s)	243, 364, 453, 520, 652, 1321
MluNI	TGGCCA	2 cut(s)	294, 486
MlyI	GAGTC	3 cut(s)	470, 950, 1076
MmeI	TCCRAC	1 cut(s)	1054
Mox20I	TGGCCA	2 cut(s)	294, 486
Mph1103I	ATGCAT	1 cut(s)	629
MroXI	GAANNNNTTC	3 cut(s)	840, 1325, 1377
MscI	TGGCCA	2 cut(s)	294, 486
MseI	TTAA	2 cut(s)	402, 993
MslI	CAYNNNNRTG	3 cut(s)	492, 609, 1548
Msp20I	TGGCCA	2 cut(s)	294, 486
MspA1I	CMGCKG	2 cut(s)	1053, 1113
MspI	CCGG	3 cut(s)	234, 903, 1559
MspR9I	CCNGG	3 cut(s)	235, 509, 1287
Mva1269I	GAATGC	2 cut(s)	50, 627
MvaI	CCWGG	2 cut(s)	509, 1287
MvnI	CGCG	2 cut(s)	1087, 1089
MwoI	GCNNNNNNNGC	2 cut(s)	588, 810
NciI	CCSGG	1 cut(s)	235
NcoI	CCATGG	1 cut(s)	546
NdeII	GATC	6 cut(s)	186, 408, 668, 985, 1151, 1417
NlaIII	CATG	6 cut(s)	214, 550, 599, 627, 1210, 1268
NlaIV	GGNNCC	4 cut(s)	670, 793, 1341, 1342
NmuCI	GTSAC	1 cut(s)	462
NsbI	TGCGCA	1 cut(s)	332
NsiI	ATGCAT	1 cut(s)	629
NspI	RCATGY	2 cut(s)	599, 627
NspV	TTCGAA	1 cut(s)	451
PaeR7I	CTCGAG	1 cut(s)	687
PciI	ACATGT	1 cut(s)	595
PciSI	GCTCTTC	1 cut(s)	846
PctI	GAATGC	2 cut(s)	50, 627
PdmI	GAANNNNTTC	3 cut(s)	840, 1325, 1377
PfeI	GAWTC	4 cut(s)	824, 859, 1298, 1391
PkrI	GCNGC	1 cut(s)	812
PleI	GAGTC	3 cut(s)	469, 950, 1076
PpsI	GAGTC	3 cut(s)	469, 950, 1076
PpuMI	RGGWCCY	1 cut(s)	1340
PscI	ACATGT	1 cut(s)	595
PsiI	TTATAA	1 cut(s)	101
Psp5II	RGGWCCY	1 cut(s)	1340
Psp6I	CCWGG	2 cut(s)	507, 1285
PspGI	CCWGG	2 cut(s)	507, 1285
PspN4I	GGNNCC	4 cut(s)	670, 793, 1341, 1342
PspPI	GGNCC	3 cut(s)	64, 1340, 1365
PspPPI	RGGWCCY	1 cut(s)	1340
PspXI	VCTCGAGB	1 cut(s)	687
PstI	CTGCAG	1 cut(s)	1349
PsuI	RGATCY	2 cut(s)	668, 985
PvuII	CAGCTG	1 cut(s)	1113
RsaI	GTAC	1 cut(s)	209
RsaNI	GTAC	1 cut(s)	208
RseI	CAYNNNNRTG	3 cut(s)	492, 609, 1548
SapI	GCTCTTC	1 cut(s)	846
SaqAI	TTAA	2 cut(s)	402, 993
SatI	GCNGC	1 cut(s)	811
Sau3AI	GATC	6 cut(s)	186, 408, 668, 985, 1151, 1417
Sau96I	GGNCC	3 cut(s)	64, 1340, 1365
SchI	GAGTC	3 cut(s)	470, 950, 1076
ScrFI	CCNGG	3 cut(s)	235, 509, 1287
SfaNI	GCATC	2 cut(s)	343, 915
SfcI	CTRYAG	2 cut(s)	1114, 1345
Sfr274I	CTCGAG	1 cut(s)	687
SfuI	TTCGAA	1 cut(s)	451
SinI	GGWCC	1 cut(s)	1340
SlaI	CTCGAG	1 cut(s)	687
SmiMI	CAYNNNNRTG	3 cut(s)	492, 609, 1548
SmlI	CTYRAG	2 cut(s)	378, 687
SmoI	CTYRAG	2 cut(s)	378, 687
Sse9I	AATT	6 cut(s)	243, 364, 453, 520, 652, 1321
SsiI	CCGC	3 cut(s)	811, 1053, 1514
SspMI	CTAG	2 cut(s)	873, 1239
StyD4I	CCNGG	3 cut(s)	233, 507, 1285
StyI	CCWWGG	2 cut(s)	546, 1196
TaaI	ACNGT	5 cut(s)	96, 200, 446, 530, 559
TaiI	ACGT	2 cut(s)	1063, 1493
TaqI	TCGA	4 cut(s)	424, 451, 688, 1150
TasI	AATT	6 cut(s)	243, 364, 453, 520, 652, 1321
TauI	GCSGC	1 cut(s)	813
TfiI	GAWTC	4 cut(s)	824, 859, 1298, 1391
Tru1I	TTAA	2 cut(s)	402, 993
Tru9I	TTAA	2 cut(s)	402, 993
TscAI	CASTG	5 cut(s)	499, 593, 670, 1391, 1427
TseFI	GTSAC	1 cut(s)	462
Tsp45I	GTSAC	1 cut(s)	462
TspDTI	ATGAA	6 cut(s)	197, 290, 649, 834, 851, 857
TspGWI	ACGGA	1 cut(s)	956
TspRI	CASTG	5 cut(s)	499, 593, 670, 1391, 1427
VpaK11BI	GGWCC	1 cut(s)	1340
XagI	CCTNNNNNAGG	1 cut(s)	1200
XapI	RAATTY	2 cut(s)	243, 520
XbaI	TCTAGA	1 cut(s)	872
XceI	RCATGY	2 cut(s)	599, 627
XcmI	CCANNNNNNNNNTGG	1 cut(s)	479
XhoI	CTCGAG	1 cut(s)	687
XmnI	GAANNNNTTC	3 cut(s)	840, 1325, 1377
XspI	CTAG	2 cut(s)	873, 1239
Zsp2I	ATGCAT	1 cut(s)	629

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.