RLG00000022360

No description available

Basic Information

Type: gene
Biological Identity
rosa_laevigata
Chr4
Physical Location & Seq
Reverse (-)
82835596 .. 82838597
3002 bp
Loading structure...
UTR
Exon/CDS
Intron
RLM00000022360

Sequence Viewer

Length: 363 bp
ATGGATGTTGAAGTGAGTTGCATGGATTTAAGGAAGACCAGAAGTAGGTCCAATACTCATAGAAAGAGACCTGTAACTAAGAACGAGCTGAGGCAGAAGGTAAAGATAAGGGCAGAAAAACTGAAGAAAAAGAGAGATGAACAAAAGGCAGCAGCAGTAAAAGTATCAAATGCTTCAGGCATGCCAAAAGGTAAACCTCCAAAGGCTTCAGCAACTTCTGCCCCAGCTCCAACAAATGCTAAAGCTCCTCCTGCTACAACAAGGTCTAAACCTCCAGCCAAGCCATCATCATCTTCTAAACAAGCAGCTCTGAGTAGGTCCTCTAGCAGAATCAGAGATAATGCAAAGGATGGGAAAAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

121

Amino Acids

13.02

Weight (kDa)

11.3

Isoelectric Point (pI)

68.89

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcuI CTGAAG 3 cut(s) 143, 159, 192
AfiI CCNNNNNNNGG 1 cut(s) 45
AgsI TTSAA 1 cut(s) 11
AluBI AGCT 4 cut(s) 88, 227, 245, 308
AluI AGCT 4 cut(s) 88, 227, 245, 308
Alw26I GTCTC 1 cut(s) 61
ApeKI GCWGC 3 cut(s) 149, 152, 305
AspS9I GGNCC 2 cut(s) 48, 318
AvaII GGWCC 2 cut(s) 48, 318
BbsI GAAGAC 1 cut(s) 41
BbvCI CCTCAGC 1 cut(s) 89
BbvI GCAGC 3 cut(s) 161, 164, 317
BccI CCATC 2 cut(s) 292, 344
BcoDI GTCTC 1 cut(s) 61
BfaI CTAG 1 cut(s) 324
BisI GCNGC 3 cut(s) 150, 153, 306
BlsI GCNGC 3 cut(s) 151, 154, 307
Bme18I GGWCC 2 cut(s) 48, 318
BmgT120I GGNCC 2 cut(s) 48, 318
BpiI GAAGAC 1 cut(s) 41
BpmI CTGGAG 1 cut(s) 258
Bpu10I CCTNAGC 1 cut(s) 89
BsaI GGTCTC 1 cut(s) 61
Bsc4I CCNNNNNNNGG 1 cut(s) 45
BseGI GGATG 2 cut(s) 10, 355
BseLI CCNNNNNNNGG 1 cut(s) 45
BseMII CTCAG 2 cut(s) 80, 302
BseRI GAGGAG 1 cut(s) 237
BseXI GCAGC 3 cut(s) 161, 164, 317
BseYI CCCAGC 1 cut(s) 223
BslI CCNNNNNNNGG 1 cut(s) 45
BsmAI GTCTC 1 cut(s) 61
Bso31I GGTCTC 1 cut(s) 61
BspCNI CTCAG 2 cut(s) 81, 303
BspTNI GGTCTC 1 cut(s) 61
BstAPI GCANNNNNTGC 1 cut(s) 218
BstC8I GCNNGC 1 cut(s) 182
BstDEI CTNAG 3 cut(s) 78, 89, 311
BstF5I GGATG 2 cut(s) 10, 355
BstMAI GTCTC 1 cut(s) 61
BstMWI GCNNNNNNNGC 2 cut(s) 218, 251
BstNSI RCATGY 1 cut(s) 184
BstV1I GCAGC 3 cut(s) 161, 164, 317
BstV2I GAAGAC 1 cut(s) 41
BtsCI GGATG 2 cut(s) 10, 355
Cac8I GCNNGC 1 cut(s) 182
Cfr13I GGNCC 2 cut(s) 48, 318
CviAII CATG 2 cut(s) 22, 181
CviJI RGCY 7 cut(s) 88, 206, 227, 245, 278, 283, 308
CviKI_1 RGCY 7 cut(s) 88, 206, 227, 245, 278, 283, 308
DdeI CTNAG 3 cut(s) 78, 89, 311
Eco31I GGTCTC 1 cut(s) 61
Eco47I GGWCC 2 cut(s) 48, 318
Eco57I CTGAAG 3 cut(s) 143, 159, 192
EcoO109I RGGNCCY 1 cut(s) 318
FaeI CATG 2 cut(s) 25, 184
FaiI YATR 3 cut(s) 23, 60, 182
FatI CATG 2 cut(s) 21, 180
Fnu4HI GCNGC 3 cut(s) 150, 153, 306
FokI GGATG 1 cut(s) 17
Fsp4HI GCNGC 3 cut(s) 150, 153, 306
FspBI CTAG 1 cut(s) 324
GluI GCNGC 3 cut(s) 150, 153, 306
GsaI CCCAGC 1 cut(s) 227
GsuI CTGGAG 1 cut(s) 258
Hin1II CATG 2 cut(s) 25, 184
HinfI GANTC 1 cut(s) 330
Hpy166II GTNNAC 1 cut(s) 194
Hpy188I TCNGA 2 cut(s) 312, 335
Hpy8I GTNNAC 1 cut(s) 194
HpyAV CCTTC 1 cut(s) 91
HpyCH4V TGCA 2 cut(s) 21, 344
HpyF10VI GCNNNNNNNGC 2 cut(s) 218, 251
HpyF3I CTNAG 3 cut(s) 78, 89, 311
Hsp92II CATG 2 cut(s) 25, 184
LmnI GCTCC 2 cut(s) 232, 250
LpnPI CCDG 6 cut(s) 52, 84, 162, 237, 264, 288
Lsp1109I GCAGC 3 cut(s) 161, 164, 317
MaeI CTAG 1 cut(s) 324
MaeIII GTNAC 1 cut(s) 73
MboII GAAGA 3 cut(s) 46, 136, 285
MmeI TCCRAC 1 cut(s) 254
MnlI CCTC 5 cut(s) 84, 207, 258, 282, 331
MseI TTAA 1 cut(s) 29
MwoI GCNNNNNNNGC 2 cut(s) 218, 251
NlaIII CATG 2 cut(s) 25, 184
NspI RCATGY 1 cut(s) 184
PaeI GCATGC 1 cut(s) 184
PfeI GAWTC 1 cut(s) 330
PkrI GCNGC 3 cut(s) 151, 154, 307
PpuMI RGGWCCY 1 cut(s) 318
Psp5II RGGWCCY 1 cut(s) 318
PspFI CCCAGC 1 cut(s) 223
PspPI GGNCC 2 cut(s) 48, 318
PspPPI RGGWCCY 1 cut(s) 318
SaqAI TTAA 1 cut(s) 29
SatI GCNGC 3 cut(s) 150, 153, 306
Sau96I GGNCC 2 cut(s) 48, 318
SinI GGWCC 2 cut(s) 48, 318
SphI GCATGC 1 cut(s) 184
SspMI CTAG 1 cut(s) 324
TfiI GAWTC 1 cut(s) 330
Tru1I TTAA 1 cut(s) 29
Tru9I TTAA 1 cut(s) 29
TseI GCWGC 3 cut(s) 149, 152, 305
TspDTI ATGAA 1 cut(s) 153
VpaK11BI GGWCC 2 cut(s) 48, 318
XceI RCATGY 1 cut(s) 184
XspI CTAG 1 cut(s) 324
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.