Rmu_sc0011772.1_g000001

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0011772.1
Physical Location & Seq
Forward (+)
1 .. 734
734 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0011772.1_g000001.1.cds

Sequence Viewer

Length: 471 bp
ggtactggtaagaaaaaggctaccaagacaaagaatgagttaaggcagaaggcaagggaaagggcagaagtactaaagaaaaaaagggatgagaagaaggctgccacagctagagctgctcccacaaatgcaagagctacttctacaaatgcaagagctgctcctacttcaagctcaagagctgctcctgcttcaagctcaagagctgctcctgcttcaagctcaagagctgctcctgcttcaagctcaagagctgctcctgcttcaagctcaagagctgctcctgcttcaagctcaagagctgctcctgcttcaagctcaagagctgctcctacttcaagctcaagagctgctcctgcttcaagctcaagagctgctcctgctttaagctcaaaaggaaccgctgcaaaaggtacagcctctgcaacacccactagatcatcaaagaggcttagagaaagtggaaaatag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

156

Amino Acids

15.47

Weight (kDa)

12.0

Isoelectric Point (pI)

74.31

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 402
AfaI GTAC 3 cut(s) 4, 72, 415
AgsI TTSAA 9 cut(s) 171, 195, 219, 243, 267, 291, 315, 339, 363
AlwNI CAGNNNCTG 1 cut(s) 422
BfaI CTAG 2 cut(s) 111, 435
BmcAI AGTACT 1 cut(s) 72
BmiI GGNNCC 1 cut(s) 400
BpuEI CTTGAG 9 cut(s) 160, 184, 208, 232, 256, 280, 304, 328, 352
Bse1I ACTGG 1 cut(s) 10
BseGI GGATG 1 cut(s) 94
BseNI ACTGG 1 cut(s) 10
Bsp143I GATC 1 cut(s) 437
BspACI CCGC 1 cut(s) 402
BspLI GGNNCC 1 cut(s) 400
BsrI ACTGG 1 cut(s) 10
BssMI GATC 1 cut(s) 437
BstAPI GCANNNNNTGC 1 cut(s) 158
BstDEI CTNAG 1 cut(s) 452
BstF5I GGATG 1 cut(s) 94
BstKTI GATC 1 cut(s) 440
BstMBI GATC 1 cut(s) 437
BtsCI GGATG 1 cut(s) 94
CaiI CAGNNNCTG 1 cut(s) 422
Csp6I GTAC 3 cut(s) 3, 71, 414
CviQI GTAC 3 cut(s) 3, 71, 414
DdeI CTNAG 1 cut(s) 452
DpnI GATC 1 cut(s) 439
DpnII GATC 1 cut(s) 437
FalI AAGNNNNNCTT 2 cut(s) 124, 156
FokI GGATG 1 cut(s) 101
FspBI CTAG 2 cut(s) 111, 435
Hpy188III TCNNGA 9 cut(s) 177, 201, 225, 249, 273, 297, 321, 345, 369
HpyAV CCTTC 2 cut(s) 43, 91
HpyCH4V TGCA 4 cut(s) 131, 152, 407, 425
HpyF3I CTNAG 1 cut(s) 452
Kzo9I GATC 1 cut(s) 437
LpnPI CCDG 8 cut(s) 201, 225, 249, 273, 297, 321, 369, 393
MaeI CTAG 2 cut(s) 111, 435
MalI GATC 1 cut(s) 439
MboI GATC 1 cut(s) 437
MboII GAAGA 1 cut(s) 106
MnlI CCTC 2 cut(s) 430, 441
MseI TTAA 2 cut(s) 41, 386
MspA1I CMGCKG 1 cut(s) 404
NdeII GATC 1 cut(s) 437
NlaIV GGNNCC 1 cut(s) 400
PspN4I GGNNCC 1 cut(s) 400
PstNI CAGNNNCTG 1 cut(s) 422
RsaI GTAC 3 cut(s) 4, 72, 415
RsaNI GTAC 3 cut(s) 3, 71, 414
SaqAI TTAA 2 cut(s) 41, 386
Sau3AI GATC 1 cut(s) 437
ScaI AGTACT 1 cut(s) 72
SmlI CTYRAG 9 cut(s) 175, 199, 223, 247, 271, 295, 319, 343, 367
SmoI CTYRAG 9 cut(s) 175, 199, 223, 247, 271, 295, 319, 343, 367
SsiI CCGC 1 cut(s) 402
SspMI CTAG 2 cut(s) 111, 435
TatI WGTACW 1 cut(s) 70
Tru1I TTAA 2 cut(s) 41, 386
Tru9I TTAA 2 cut(s) 41, 386
XspI CTAG 2 cut(s) 111, 435
ZrmI AGTACT 1 cut(s) 72
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.