Rorug01G0267700

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_rugosa
GWHBQTZ00000001
OG0005564
Physical Location & Seq
Reverse (-)
38008761 .. 38010418
1658 bp
Loading structure...
UTR
Exon/CDS
Intron
Rorug01G0267700.1

Sequence Viewer

Length: 588 bp
ATGGTGCAAGTCAAAGAATGTGATCCTAACATGGAAAAGGGGGTTTTGCTTTCTTTGAGTCCTCCGGTATCGGATAGCAGTGGAGATAACACAGCTCTCAAGCCAGCCTCTGCTCAACTGAGAATGACAGGCCCTACGAGACGATCAACAAAGGGAGGCTGGACAGAGGAAGAGGATAGAATTCTAGCAGATGCTGTCGAGAAGCATAATGGAAAGAACTGGAAAAGGATTGCTGAATGTGTTCGTGGCAGAACAGATGTTCAGTGCCTTCATCGCTGGCAGAAAGTCCTCTCACCTGATCTTGAAGATGATCTAATAATTGAGTTGGTCGCAAAGCAGGGGAATAAGAAATGGTCTGAAATAGCAAAGTCCTTGCCAGGCCGTATAGGCAAGCAATGTCGAGAGAGGTGGCACAACCATTTAAATCCAGATATAAAAAGAACTGCATGGACAAATGAAGAAGAAAAGATTCTCATTGAGTCGCATAAAGCCTACGGGAACAAATGGGCTGAAATAGCAAAGCTTCTGCCTGGAAGGTTAGAATTTGTAACATTTTGTTATCAAATGGAGAAACTAACAGCTAGATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

195

Amino Acids

22.3

Weight (kDa)

8.94

Isoelectric Point (pI)

59.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 51 - 97 5.9e-17 Myb-like DNA-binding domain
Myb_DNA-bind_6 PF13921 54 - 101 3.8e-12 Myb-like DNA-binding domain
Myb_DNA-binding PF00249 102 - 141 1.3e-14 Myb-like DNA-binding domain
Myb_DNA-bind_6 PF13921 102 - 155 2.8e-17 Myb-like DNA-binding domain
Myb_DNA-binding PF00249 147 - 179 3.7e-10 Myb-like DNA-binding domain
Myb_DNA-bind_6 PF13921 150 - 179 7.5e-07 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 17
AcsI RAATTY 2 cut(s) 180, 542
AgsI TTSAA 1 cut(s) 305
AjnI CCWGG 2 cut(s) 376, 529
AluBI AGCT 3 cut(s) 95, 523, 581
AluI AGCT 3 cut(s) 95, 523, 581
Alw26I GTCTC 1 cut(s) 133
AlwI GGATC 1 cut(s) 17
AlwNI CAGNNNCTG 2 cut(s) 110, 194
AoxI GGCC 2 cut(s) 130, 379
ApoI RAATTY 2 cut(s) 180, 542
Asp700I GAANNNNTTC 2 cut(s) 240, 468
AspS9I GGNCC 1 cut(s) 131
AsuHPI GGTGA 1 cut(s) 285
BceAI ACGGC 1 cut(s) 366
BciT130I CCWGG 2 cut(s) 378, 531
BcoDI GTCTC 1 cut(s) 133
BfaI CTAG 2 cut(s) 185, 582
BglI GCCNNNNNGGC 1 cut(s) 387
Bme1390I CCNGG 2 cut(s) 378, 531
BmgT120I GGNCC 1 cut(s) 131
BmrFI CCNGG 2 cut(s) 378, 531
BmsI GCATC 1 cut(s) 181
BpuEI CTTGAG 1 cut(s) 83
BsaWI WCCGGW 1 cut(s) 64
Bse1I ACTGG 1 cut(s) 224
Bse3DI GCAATG 1 cut(s) 401
BseBI CCWGG 2 cut(s) 378, 531
BseMI GCAATG 1 cut(s) 401
BseMII CTCAG 1 cut(s) 110
BseNI ACTGG 1 cut(s) 224
BshFI GGCC 2 cut(s) 132, 381
BsiSI CCGG 1 cut(s) 65
BsmAI GTCTC 1 cut(s) 133
BsmBI CGTCTC 1 cut(s) 133
BsnI GGCC 2 cut(s) 132, 381
Bsp143I GATC 4 cut(s) 22, 143, 298, 310
BspANI GGCC 2 cut(s) 132, 381
BspCNI CTCAG 1 cut(s) 111
BspPI GGATC 1 cut(s) 17
BsrDI GCAATG 1 cut(s) 401
BsrI ACTGG 1 cut(s) 224
BssMI GATC 4 cut(s) 22, 143, 298, 310
Bst2UI CCWGG 2 cut(s) 378, 531
Bst6I CTCTTC 1 cut(s) 165
BstC8I GCNNGC 3 cut(s) 105, 278, 392
BstDEI CTNAG 1 cut(s) 119
BstKTI GATC 4 cut(s) 25, 146, 301, 313
BstMAI GTCTC 1 cut(s) 133
BstMBI GATC 4 cut(s) 22, 143, 298, 310
BstMWI GCNNNNNNNGC 3 cut(s) 273, 387, 515
BstNI CCWGG 2 cut(s) 378, 531
BstSCI CCNGG 2 cut(s) 376, 529
BsuRI GGCC 2 cut(s) 132, 381
BtgZI GCGATG 1 cut(s) 257
BtsI GCAGTG 1 cut(s) 85
BtsIMutI CAGTG 2 cut(s) 85, 269
Cac8I GCNNGC 3 cut(s) 105, 278, 392
CaiI CAGNNNCTG 2 cut(s) 110, 194
Cfr13I GGNCC 1 cut(s) 131
CviAII CATG 2 cut(s) 31, 447
DdeI CTNAG 1 cut(s) 119
DpnI GATC 4 cut(s) 24, 145, 300, 312
DpnII GATC 4 cut(s) 22, 143, 298, 310
DraI TTTAAA 1 cut(s) 423
Eam1104I CTCTTC 1 cut(s) 165
EarI CTCTTC 1 cut(s) 165
EcoO109I RGGNCCY 1 cut(s) 131
EcoRI GAATTC 1 cut(s) 180
EcoRII CCWGG 2 cut(s) 376, 529
Esp3I CGTCTC 1 cut(s) 133
FaeI CATG 2 cut(s) 34, 450
FaiI YATR 6 cut(s) 32, 207, 386, 434, 448, 486
FatI CATG 2 cut(s) 30, 446
FspBI CTAG 2 cut(s) 185, 582
HaeIII GGCC 2 cut(s) 132, 381
HapII CCGG 1 cut(s) 65
Hin1II CATG 2 cut(s) 34, 450
HindIII AAGCTT 1 cut(s) 521
HinfI GANTC 3 cut(s) 58, 469, 479
HpaII CCGG 1 cut(s) 65
HphI GGTGA 1 cut(s) 285
Hpy188I TCNGA 2 cut(s) 73, 358
Hpy188III TCNNGA 4 cut(s) 199, 302, 401, 428
HpyAV CCTTC 2 cut(s) 278, 528
HpyCH4V TGCA 2 cut(s) 7, 446
HpyF10VI GCNNNNNNNGC 3 cut(s) 273, 387, 515
HpyF3I CTNAG 1 cut(s) 119
Hsp92II CATG 2 cut(s) 34, 450
Kzo9I GATC 4 cut(s) 22, 143, 298, 310
LweI GCATC 1 cut(s) 181
MaeI CTAG 2 cut(s) 185, 582
MaeIII GTNAC 1 cut(s) 547
MalI GATC 4 cut(s) 24, 145, 300, 312
MboI GATC 4 cut(s) 22, 143, 298, 310
MboII GAAGA 4 cut(s) 182, 317, 470, 473
MluCI AATT 3 cut(s) 180, 318, 542
MlyI GAGTC 2 cut(s) 67, 488
MnlI CCTC 7 cut(s) 72, 118, 149, 160, 166, 299, 399
MroXI GAANNNNTTC 2 cut(s) 240, 468
MseI TTAA 1 cut(s) 422
MspI CCGG 1 cut(s) 65
MspR9I CCNGG 2 cut(s) 378, 531
MvaI CCWGG 2 cut(s) 378, 531
MwoI GCNNNNNNNGC 3 cut(s) 273, 387, 515
NdeII GATC 4 cut(s) 22, 143, 298, 310
NlaIII CATG 2 cut(s) 34, 450
PdmI GAANNNNTTC 2 cut(s) 240, 468
PfeI GAWTC 1 cut(s) 469
PleI GAGTC 2 cut(s) 66, 487
PpsI GAGTC 2 cut(s) 66, 487
Psp6I CCWGG 2 cut(s) 376, 529
PspGI CCWGG 2 cut(s) 376, 529
PspPI GGNCC 1 cut(s) 131
PstNI CAGNNNCTG 2 cut(s) 110, 194
SaqAI TTAA 1 cut(s) 422
Sau3AI GATC 4 cut(s) 22, 143, 298, 310
Sau96I GGNCC 1 cut(s) 131
SchI GAGTC 2 cut(s) 67, 488
ScrFI CCNGG 2 cut(s) 378, 531
SetI ASST 6 cut(s) 97, 298, 410, 525, 539, 583
SfaNI GCATC 1 cut(s) 181
SmiI ATTTAAAT 1 cut(s) 423
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
Sse9I AATT 3 cut(s) 180, 318, 542
SspMI CTAG 2 cut(s) 185, 582
StyD4I CCNGG 2 cut(s) 376, 529
SwaI ATTTAAAT 1 cut(s) 423
TaqI TCGA 2 cut(s) 198, 400
TasI AATT 3 cut(s) 180, 318, 542
TfiI GAWTC 1 cut(s) 469
Tru1I TTAA 1 cut(s) 422
Tru9I TTAA 1 cut(s) 422
TscAI CASTG 2 cut(s) 85, 269
TspDTI ATGAA 2 cut(s) 260, 471
TspRI CASTG 2 cut(s) 85, 269
XapI RAATTY 2 cut(s) 180, 542
XmnI GAANNNNTTC 2 cut(s) 240, 468
XspI CTAG 2 cut(s) 185, 582
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.