Rh1DG276600

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
49761680 .. 49781444
19765 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG276600.1

Sequence Viewer

Length: 165 bp
ATGGCTGCGAGGTATGTGTTACATTGGTTCTTGGCTTATGAAGAAGCTTTTAGAGAAAGGCTACCCGTCCATGCTACAGGTACCAAGAAACCACAATTCACAAAGAATGAGCTTAGGGAAAAGGTTAAGCTTAGGGCAGAAAAGTTTAAGGGTGAGAGGCATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

54

Amino Acids

6.54

Weight (kDa)

10.08

Isoelectric Point (pI)

20.84

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc65I GGTACC 1 cut(s) 80
AccB1I GGYRCC 1 cut(s) 80
AfaI GTAC 1 cut(s) 82
AluBI AGCT 3 cut(s) 47, 112, 130
AluI AGCT 3 cut(s) 47, 112, 130
ApeKI GCWGC 1 cut(s) 5
Asp718I GGTACC 1 cut(s) 80
AsuHPI GGTGA 1 cut(s) 164
BanI GGYRCC 1 cut(s) 80
BfmI CTRYAG 1 cut(s) 75
BisI GCNGC 1 cut(s) 6
BlsI GCNGC 1 cut(s) 7
BmiI GGNNCC 1 cut(s) 82
Bpu10I CCTNAGC 2 cut(s) 113, 131
BshNI GGYRCC 1 cut(s) 80
BspLI GGNNCC 1 cut(s) 82
BspT107I GGYRCC 1 cut(s) 80
BstDEI CTNAG 2 cut(s) 113, 131
BstSFI CTRYAG 1 cut(s) 75
Csp6I GTAC 1 cut(s) 81
CviAII CATG 1 cut(s) 71
CviJI RGCY 6 cut(s) 5, 35, 47, 61, 112, 130
CviKI_1 RGCY 6 cut(s) 5, 35, 47, 61, 112, 130
CviQI GTAC 1 cut(s) 81
DdeI CTNAG 2 cut(s) 113, 131
FaeI CATG 1 cut(s) 74
FaiI YATR 3 cut(s) 15, 39, 72
FatI CATG 1 cut(s) 70
Fnu4HI GCNGC 1 cut(s) 6
Fsp4HI GCNGC 1 cut(s) 6
GluI GCNGC 1 cut(s) 6
Hin1II CATG 1 cut(s) 74
HindIII AAGCTT 2 cut(s) 45, 128
HphI GGTGA 1 cut(s) 164
HpyF3I CTNAG 2 cut(s) 113, 131
Hsp92II CATG 1 cut(s) 74
KpnI GGTACC 1 cut(s) 84
LpnPI CCDG 1 cut(s) 63
MaeIII GTNAC 1 cut(s) 18
MboII GAAGA 1 cut(s) 53
MluCI AATT 1 cut(s) 95
MnlI CCTC 2 cut(s) 3, 150
MseI TTAA 2 cut(s) 126, 147
NlaIII CATG 1 cut(s) 74
NlaIV GGNNCC 1 cut(s) 82
PkrI GCNGC 1 cut(s) 7
PspN4I GGNNCC 1 cut(s) 82
RsaI GTAC 1 cut(s) 82
RsaNI GTAC 1 cut(s) 81
SaqAI TTAA 2 cut(s) 126, 147
SatI GCNGC 1 cut(s) 6
SetI ASST 6 cut(s) 14, 49, 82, 114, 126, 132
SfcI CTRYAG 1 cut(s) 75
SgeI CNNG 6 cut(s) 21, 43, 77, 83, 90, 97
Sse9I AATT 1 cut(s) 95
TasI AATT 1 cut(s) 95
Tru1I TTAA 2 cut(s) 126, 147
Tru9I TTAA 2 cut(s) 126, 147
TseI GCWGC 1 cut(s) 5
TspDTI ATGAA 1 cut(s) 54
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.