Rroxscaffold_4G00316120

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_roxburghii
GWHEROQ00000004
OG0005564
Physical Location & Seq
Reverse (-)
40755184 .. 40756891
1708 bp
Loading structure...
UTR
Exon/CDS
Intron
Rroxscaffold_4G00316120.1

Sequence Viewer

Length: 459 bp
ATGTGGAAAAAATTTTGGGGGTTTGATTGTGGGTGGAATGGGTTTATGAATGACAAAGTCTGTAGCTTTGTTGTTGCATCTTTCAGTGTTGATTGTGTCCTTCTCTTTAATGCAGATCACCCAGATTACTTCACTGTGAAGATGTATCATGGTGTGGATACGTCAAAGACAACAGTTATAGGCACTGGTACTGGTAAGAAAAAGCCTCCCTTGACAAAGAATGAGTTAAGGCAGAAGGCAAAGCAAGGGGTAGAAAAACTAAAGAAAAAGAGGGATGAGAAGAAGGCTGCCTTAGCTAGAGCTGCTCCTACAAATGCAAGAGATTCTCATTCTGCAAATGCAAGAGTTGCACCTTCCACAAATGCATGCGCTGCTGCTTCAAGCTCTCAAGCTGCTCCTTCAAGCTCCAAAGTAACTGCTACAAAAGGTAAAACTCTTGAATTAATCATTTTATGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

152

Amino Acids

16.46

Weight (kDa)

9.74

Isoelectric Point (pI)

25.5

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 11
AfaI GTAC 1 cut(s) 190
AgsI TTSAA 3 cut(s) 381, 402, 440
AluBI AGCT 6 cut(s) 66, 296, 302, 384, 392, 405
AluI AGCT 6 cut(s) 66, 296, 302, 384, 392, 405
ApeKI GCWGC 5 cut(s) 287, 302, 371, 374, 392
ApoI RAATTY 1 cut(s) 11
AseI ATTAAT 1 cut(s) 443
AspLEI GCGC 1 cut(s) 371
AsuHPI GGTGA 1 cut(s) 110
BbvI GCAGC 5 cut(s) 274, 289, 358, 361, 379
BciVI GTATCC 1 cut(s) 151
BfaI CTAG 1 cut(s) 297
BfmI CTRYAG 1 cut(s) 61
BfuI GTATCC 1 cut(s) 151
BisI GCNGC 5 cut(s) 288, 303, 372, 375, 393
BlsI GCNGC 5 cut(s) 289, 304, 373, 376, 394
BmsI GCATC 1 cut(s) 86
Bpu10I CCTNAGC 1 cut(s) 292
BpuEI CTTGAG 1 cut(s) 372
Bse1I ACTGG 2 cut(s) 190, 196
BseGI GGATG 1 cut(s) 280
BseNI ACTGG 2 cut(s) 190, 196
BseXI GCAGC 5 cut(s) 274, 289, 358, 361, 379
Bsp143I GATC 1 cut(s) 115
BsrI ACTGG 2 cut(s) 190, 196
BssMI GATC 1 cut(s) 115
Bst4CI ACNGT 2 cut(s) 136, 175
BstAPI GCANNNNNTGC 2 cut(s) 347, 371
BstC8I GCNNGC 1 cut(s) 367
BstDEI CTNAG 1 cut(s) 292
BstF5I GGATG 1 cut(s) 280
BstHHI GCGC 1 cut(s) 371
BstKTI GATC 1 cut(s) 118
BstMBI GATC 1 cut(s) 115
BstMWI GCNNNNNNNGC 4 cut(s) 293, 302, 347, 371
BstNSI RCATGY 1 cut(s) 369
BstSFI CTRYAG 1 cut(s) 61
BstV1I GCAGC 5 cut(s) 274, 289, 358, 361, 379
BsuI GTATCC 1 cut(s) 151
BtsCI GGATG 1 cut(s) 280
BtsIMutI CAGTG 3 cut(s) 91, 132, 183
Cac8I GCNNGC 1 cut(s) 367
CfoI GCGC 1 cut(s) 371
Csp6I GTAC 1 cut(s) 189
CviAII CATG 2 cut(s) 149, 366
CviJI RGCY 8 cut(s) 66, 205, 287, 296, 302, 384, 392, 405
CviKI_1 RGCY 8 cut(s) 66, 205, 287, 296, 302, 384, 392, 405
CviQI GTAC 1 cut(s) 189
DdeI CTNAG 1 cut(s) 292
DpnI GATC 1 cut(s) 117
DpnII GATC 1 cut(s) 115
EcoT22I ATGCAT 1 cut(s) 367
FaeI CATG 2 cut(s) 152, 369
FaiI YATR 5 cut(s) 47, 150, 179, 367, 454
FalI AAGNNNNNCTT 4 cut(s) 194, 226, 275, 307
FatI CATG 2 cut(s) 148, 365
Fnu4HI GCNGC 5 cut(s) 288, 303, 372, 375, 393
FokI GGATG 1 cut(s) 287
Fsp4HI GCNGC 5 cut(s) 288, 303, 372, 375, 393
FspBI CTAG 1 cut(s) 297
GlaI GCGC 1 cut(s) 370
GluI GCNGC 5 cut(s) 288, 303, 372, 375, 393
HhaI GCGC 1 cut(s) 371
Hin1II CATG 2 cut(s) 152, 369
Hin6I GCGC 1 cut(s) 369
HinP1I GCGC 1 cut(s) 369
HinfI GANTC 1 cut(s) 323
HphI GGTGA 1 cut(s) 110
Hpy188III TCNNGA 1 cut(s) 437
HpyAV CCTTC 5 cut(s) 110, 229, 277, 363, 408
HpyCH4III ACNGT 2 cut(s) 136, 175
HpyCH4IV ACGT 1 cut(s) 161
HpyCH4V TGCA 7 cut(s) 77, 113, 317, 335, 341, 350, 365
HpyF10VI GCNNNNNNNGC 4 cut(s) 293, 302, 347, 371
HpyF3I CTNAG 1 cut(s) 292
HpySE526I ACGT 1 cut(s) 161
Hsp92II CATG 2 cut(s) 152, 369
HspAI GCGC 1 cut(s) 369
Kzo9I GATC 1 cut(s) 115
LmnI GCTCC 3 cut(s) 310, 400, 410
LpnPI CCDG 3 cut(s) 135, 171, 177
Lsp1109I GCAGC 5 cut(s) 274, 289, 358, 361, 379
LweI GCATC 1 cut(s) 86
MaeI CTAG 1 cut(s) 297
MaeII ACGT 1 cut(s) 161
MaeIII GTNAC 1 cut(s) 412
MalI GATC 1 cut(s) 117
MboI GATC 1 cut(s) 115
MboII GAAGA 2 cut(s) 151, 292
MluCI AATT 2 cut(s) 11, 440
MnlI CCTC 2 cut(s) 216, 264
Mph1103I ATGCAT 1 cut(s) 367
MseI TTAA 3 cut(s) 108, 227, 443
MwoI GCNNNNNNNGC 4 cut(s) 293, 302, 347, 371
NdeII GATC 1 cut(s) 115
NlaIII CATG 2 cut(s) 152, 369
NsiI ATGCAT 1 cut(s) 367
NspI RCATGY 1 cut(s) 369
PaeI GCATGC 1 cut(s) 369
PfeI GAWTC 1 cut(s) 323
PflFI GACNNNGTC 1 cut(s) 56
PkrI GCNGC 5 cut(s) 289, 304, 373, 376, 394
PshBI ATTAAT 1 cut(s) 443
PsyI GACNNNGTC 1 cut(s) 56
RsaI GTAC 1 cut(s) 190
RsaNI GTAC 1 cut(s) 189
SaqAI TTAA 3 cut(s) 108, 227, 443
SatI GCNGC 5 cut(s) 288, 303, 372, 375, 393
Sau3AI GATC 1 cut(s) 115
SetI ASST 9 cut(s) 68, 164, 298, 304, 355, 386, 394, 407, 430
SfaNI GCATC 1 cut(s) 86
SfcI CTRYAG 1 cut(s) 61
SmlI CTYRAG 1 cut(s) 387
SmoI CTYRAG 1 cut(s) 387
SphI GCATGC 1 cut(s) 369
Sse9I AATT 2 cut(s) 11, 440
SspMI CTAG 1 cut(s) 297
TaaI ACNGT 2 cut(s) 136, 175
TaiI ACGT 1 cut(s) 164
TasI AATT 2 cut(s) 11, 440
TfiI GAWTC 1 cut(s) 323
Tru1I TTAA 3 cut(s) 108, 227, 443
Tru9I TTAA 3 cut(s) 108, 227, 443
TscAI CASTG 3 cut(s) 91, 139, 190
TseI GCWGC 5 cut(s) 287, 302, 371, 374, 392
TspDTI ATGAA 1 cut(s) 62
TspRI CASTG 3 cut(s) 91, 139, 190
Tth111I GACNNNGTC 1 cut(s) 56
VspI ATTAAT 1 cut(s) 443
XapI RAATTY 1 cut(s) 11
XceI RCATGY 1 cut(s) 369
XspI CTAG 1 cut(s) 297
Zsp2I ATGCAT 1 cut(s) 367
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.