Rh1DG148500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr1D
Physical Location & Seq
Forward (+)
30994107 .. 30995136
1030 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh1DG148500.1

Sequence Viewer

Length: 291 bp
ATGGATGTAGCTTTCTTGTTGCATCTTTCAGATTATTTCACTATGAAGATGTATCATGGTGGATACAACAGAGACAACAGTTATAGGCACTTTTCAAAGAAGTTTGAAGGTACTAGTAAGAAAAAGCCTCCCTTGACAAAGAATGAGTTAAGGCAGAAGGCAAAGCCAGGGGTAGAAAAACTAAAGAAAAAGAGGGATGAGAAGAAGGCTGCCATAGCTAGAGCTGCTCCTACAAATGCAAGAGATGCTCATTCTGCAAATGCAAGAGTTGCACCTTCCACAAATGCATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

96

Amino Acids

10.88

Weight (kDa)

10.22

Isoelectric Point (pI)

22.72

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfaI GTAC 1 cut(s) 112
AgsI TTSAA 2 cut(s) 96, 107
AhlI ACTAGT 1 cut(s) 113
AjnI CCWGG 1 cut(s) 166
AluBI AGCT 3 cut(s) 11, 218, 224
AluI AGCT 3 cut(s) 11, 218, 224
Alw26I GTCTC 1 cut(s) 66
ApeKI GCWGC 2 cut(s) 209, 224
BbvI GCAGC 2 cut(s) 196, 211
BciT130I CCWGG 1 cut(s) 168
BciVI GTATCC 1 cut(s) 56
BcoDI GTCTC 1 cut(s) 66
BcuI ACTAGT 1 cut(s) 113
BfaI CTAG 2 cut(s) 114, 219
BfuI GTATCC 1 cut(s) 56
BisI GCNGC 2 cut(s) 210, 225
BlsI GCNGC 2 cut(s) 211, 226
Bme1390I CCNGG 1 cut(s) 168
BmrFI CCNGG 1 cut(s) 168
BmsI GCATC 2 cut(s) 31, 235
BsaJI CCNNGG 1 cut(s) 167
BseBI CCWGG 1 cut(s) 168
BseDI CCNNGG 1 cut(s) 167
BseGI GGATG 2 cut(s) 10, 202
BseXI GCAGC 2 cut(s) 196, 211
BsmAI GTCTC 1 cut(s) 66
BssECI CCNNGG 1 cut(s) 167
Bst2UI CCWGG 1 cut(s) 168
Bst4CI ACNGT 1 cut(s) 80
BstAPI GCANNNNNTGC 2 cut(s) 245, 269
BstF5I GGATG 2 cut(s) 10, 202
BstMAI GTCTC 1 cut(s) 66
BstMWI GCNNNNNNNGC 5 cut(s) 215, 224, 245, 254, 269
BstNI CCWGG 1 cut(s) 168
BstSCI CCNGG 1 cut(s) 166
BstV1I GCAGC 2 cut(s) 196, 211
BsuI GTATCC 1 cut(s) 56
BtsCI GGATG 2 cut(s) 10, 202
Csp6I GTAC 1 cut(s) 111
CviAII CATG 2 cut(s) 56, 288
CviJI RGCY 6 cut(s) 11, 127, 166, 209, 218, 224
CviKI_1 RGCY 6 cut(s) 11, 127, 166, 209, 218, 224
CviQI GTAC 1 cut(s) 111
EcoRII CCWGG 1 cut(s) 166
EcoT22I ATGCAT 1 cut(s) 289
FaeI CATG 2 cut(s) 59, 291
FaiI YATR 5 cut(s) 44, 57, 84, 215, 289
FalI AAGNNNNNCTT 2 cut(s) 116, 148
FatI CATG 2 cut(s) 55, 287
Fnu4HI GCNGC 2 cut(s) 210, 225
FokI GGATG 2 cut(s) 17, 209
Fsp4HI GCNGC 2 cut(s) 210, 225
FspBI CTAG 2 cut(s) 114, 219
GluI GCNGC 2 cut(s) 210, 225
Hin1II CATG 2 cut(s) 59, 291
Hpy188I TCNGA 1 cut(s) 31
HpyAV CCTTC 4 cut(s) 101, 151, 199, 285
HpyCH4III ACNGT 1 cut(s) 80
HpyCH4V TGCA 6 cut(s) 22, 239, 257, 263, 272, 287
HpyF10VI GCNNNNNNNGC 5 cut(s) 215, 224, 245, 254, 269
Hsp92II CATG 2 cut(s) 59, 291
LmnI GCTCC 1 cut(s) 232
LpnPI CCDG 2 cut(s) 153, 180
Lsp1109I GCAGC 2 cut(s) 196, 211
LweI GCATC 2 cut(s) 31, 235
MaeI CTAG 2 cut(s) 114, 219
MboII GAAGA 2 cut(s) 58, 214
MnlI CCTC 2 cut(s) 138, 186
Mph1103I ATGCAT 1 cut(s) 289
MseI TTAA 1 cut(s) 149
MspR9I CCNGG 1 cut(s) 168
MvaI CCWGG 1 cut(s) 168
MwoI GCNNNNNNNGC 5 cut(s) 215, 224, 245, 254, 269
NlaIII CATG 2 cut(s) 59, 291
NsiI ATGCAT 1 cut(s) 289
PkrI GCNGC 2 cut(s) 211, 226
Psp6I CCWGG 1 cut(s) 166
PspGI CCWGG 1 cut(s) 166
RsaI GTAC 1 cut(s) 112
RsaNI GTAC 1 cut(s) 111
SaqAI TTAA 1 cut(s) 149
SatI GCNGC 2 cut(s) 210, 225
ScrFI CCNGG 1 cut(s) 168
SetI ASST 5 cut(s) 13, 112, 220, 226, 277
SfaNI GCATC 2 cut(s) 31, 235
SgeI CNNG 9 cut(s) 28, 68, 126, 145, 179, 180, 231, 252, 276
SpeI ACTAGT 1 cut(s) 113
SspMI CTAG 2 cut(s) 114, 219
StyD4I CCNGG 1 cut(s) 166
TaaI ACNGT 1 cut(s) 80
Tru1I TTAA 1 cut(s) 149
Tru9I TTAA 1 cut(s) 149
TseI GCWGC 2 cut(s) 209, 224
TspDTI ATGAA 1 cut(s) 59
XspI CTAG 2 cut(s) 114, 219
Zsp2I ATGCAT 1 cut(s) 289
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.