Rh3CG274500

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr3C
Physical Location & Seq
Reverse (-)
27262331 .. 27262887
557 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh3CG274500.1

Sequence Viewer

Length: 261 bp
ATGCAGCAATTTCTGAAACTCAGAAAAAAGAGAGATGAACAAAAGGCAGCAACAGTAAAAGGATCAAATGCTTCAGGCAAGCCAAAATGTAGACCTCCAAAGTCTTCAGCAACTTCTGTCCCAGCTCCAGCAAATGCTAAAGCTCCTCCTGCTACAACAAGGTCTAAACCTCTAGCTAAGCCATCATCATCTTCTAAACAAGCAGCACTAACTAGATCCTCTAGCAGAATCAGAGATAATGCAAAGGATGAGAAAAAGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

86

Amino Acids

9.19

Weight (kDa)

11.18

Isoelectric Point (pI)

62.77

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 91
AclWI GGATC 2 cut(s) 70, 210
AcuI CTGAAG 2 cut(s) 57, 90
AluBI AGCT 3 cut(s) 125, 143, 176
AluI AGCT 3 cut(s) 125, 143, 176
AlwI GGATC 2 cut(s) 70, 210
ApeKI GCWGC 3 cut(s) 4, 47, 203
BbsI GAAGAC 1 cut(s) 96
BbvI GCAGC 3 cut(s) 16, 59, 215
BccI CCATC 1 cut(s) 190
BfaI CTAG 3 cut(s) 173, 213, 222
BisI GCNGC 3 cut(s) 5, 48, 204
BlpI GCTNAGC 1 cut(s) 177
BlsI GCNGC 3 cut(s) 6, 49, 205
BpiI GAAGAC 1 cut(s) 96
BpmI CTGGAG 1 cut(s) 111
Bpu1102I GCTNAGC 1 cut(s) 177
BseGI GGATG 1 cut(s) 253
BseMII CTCAG 1 cut(s) 34
BseRI GAGGAG 1 cut(s) 135
BseXI GCAGC 3 cut(s) 16, 59, 215
BseYI CCCAGC 1 cut(s) 121
BslFI GGGAC 1 cut(s) 104
BsmFI GGGAC 1 cut(s) 104
Bsp143I GATC 2 cut(s) 62, 215
Bsp1720I GCTNAGC 1 cut(s) 177
BspCNI CTCAG 1 cut(s) 33
BspPI GGATC 2 cut(s) 70, 210
BssMI GATC 2 cut(s) 62, 215
Bst4CI ACNGT 1 cut(s) 55
BstC8I GCNNGC 1 cut(s) 80
BstDEI CTNAG 2 cut(s) 20, 177
BstF5I GGATG 1 cut(s) 253
BstKTI GATC 2 cut(s) 65, 218
BstMBI GATC 2 cut(s) 62, 215
BstMWI GCNNNNNNNGC 1 cut(s) 149
BstV1I GCAGC 3 cut(s) 16, 59, 215
BstV2I GAAGAC 1 cut(s) 96
BstX2I RGATCY 1 cut(s) 215
BstYI RGATCY 1 cut(s) 215
BtsCI GGATG 1 cut(s) 253
Cac8I GCNNGC 1 cut(s) 80
CviJI RGCY 5 cut(s) 82, 125, 143, 176, 181
CviKI_1 RGCY 5 cut(s) 82, 125, 143, 176, 181
DdeI CTNAG 2 cut(s) 20, 177
DpnI GATC 2 cut(s) 64, 217
DpnII GATC 2 cut(s) 62, 215
Eco57I CTGAAG 2 cut(s) 57, 90
FaqI GGGAC 1 cut(s) 104
FblI GTMKAC 1 cut(s) 91
Fnu4HI GCNGC 3 cut(s) 5, 48, 204
Fsp4HI GCNGC 3 cut(s) 5, 48, 204
FspBI CTAG 3 cut(s) 173, 213, 222
GluI GCNGC 3 cut(s) 5, 48, 204
GsaI CCCAGC 1 cut(s) 125
GsuI CTGGAG 1 cut(s) 111
HinfI GANTC 1 cut(s) 228
Hpy166II GTNNAC 1 cut(s) 92
Hpy188I TCNGA 3 cut(s) 15, 23, 233
Hpy8I GTNNAC 1 cut(s) 92
HpyCH4III ACNGT 1 cut(s) 55
HpyCH4V TGCA 2 cut(s) 4, 242
HpyF10VI GCNNNNNNNGC 1 cut(s) 149
HpyF3I CTNAG 2 cut(s) 20, 177
Kzo9I GATC 2 cut(s) 62, 215
LmnI GCTCC 2 cut(s) 130, 148
LpnPI CCDG 4 cut(s) 60, 135, 141, 162
Lsp1109I GCAGC 3 cut(s) 16, 59, 215
MaeI CTAG 3 cut(s) 173, 213, 222
MalI GATC 2 cut(s) 64, 217
MboI GATC 2 cut(s) 62, 215
MboII GAAGA 2 cut(s) 96, 183
MflI RGATCY 1 cut(s) 215
MluCI AATT 1 cut(s) 8
MnlI CCTC 4 cut(s) 105, 156, 180, 229
MwoI GCNNNNNNNGC 1 cut(s) 149
NdeII GATC 2 cut(s) 62, 215
PfeI GAWTC 1 cut(s) 228
PkrI GCNGC 3 cut(s) 6, 49, 205
PspFI CCCAGC 1 cut(s) 121
PsuI RGATCY 1 cut(s) 215
SatI GCNGC 3 cut(s) 5, 48, 204
Sau3AI GATC 2 cut(s) 62, 215
SetI ASST 6 cut(s) 97, 127, 145, 164, 172, 178
Sse9I AATT 1 cut(s) 8
SspMI CTAG 3 cut(s) 173, 213, 222
TaaI ACNGT 1 cut(s) 55
TasI AATT 1 cut(s) 8
TfiI GAWTC 1 cut(s) 228
TseI GCWGC 3 cut(s) 4, 47, 203
TspDTI ATGAA 1 cut(s) 51
XmiI GTMKAC 1 cut(s) 91
XspI CTAG 3 cut(s) 173, 213, 222
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.