Basic Information

Type: gene

Biological Identity

Species

rosa_multiflora

Chromosome

Rmu_co7960774.1

Orthogroup ID

OG0004208

Physical Location & Seq

Genomic Coordinates Reverse (-)

1 .. 346

Gene Structure 346 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rmu_co7960774.1_g000001.1.cds

Sequence Viewer

CDS Protein Promoter (2k)

Length: 244 bp

atgatgcaggtcataaaaatagatggccatgaagcagatgatgttatagctactcttgcggaacaagttctacaaataggatatcaagtggtgattgcgtctcctgataaagattttaagcaattgctttcagaagatgtccaaatcgtaatgcccctggacgatttaaagcgctggtccttttacacccttaagcactacatggctcagtataattgtgatccgtgctgtgatttgagcctca

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003824 GO:0003887 GO:0004518 GO:0004527 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0006139 GO:0006259 GO:0006260 GO:0006261 GO:0006281 GO:0006725 GO:0006807 GO:0006950 GO:0006974 GO:0008150 GO:0008152 GO:0008409 GO:0009058 GO:0009059 GO:0009987 GO:0016740 GO:0016772 GO:0016779 GO:0016787 GO:0016788 GO:0018130 GO:0019438 GO:0033554 GO:0034061 GO:0034641 GO:0034645 GO:0034654 GO:0043170 GO:0044237 GO:0044238 GO:0044249 GO:0044260 GO:0044271 GO:0044424 GO:0044464 GO:0046483 GO:0050896 GO:0051716 GO:0071704 GO:0071897 GO:0090304 GO:0090305 GO:0140097 GO:1901360 GO:1901362 GO:1901576

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

5_3_exonuc 5_3_exonuc_N

Protein Analysis

81

Amino Acids

9.31

Weight (kDa)

4.36

Isoelectric Point (pI)

47.61

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0004208)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT1G34380 AT1G34380 AT1G34380
fragaria_vesca	FvH4_2g12160 FvH4_2g12160 FvH4_2g12160 FvH4_2g12160 FvH4_2g12160 FvH4_2g12160
malus_domestica	MD05G1040800.v1.1 MD10G1046800.v1.1
prunus_persica	Prupe.8G055700_v2.0.a1 Prupe.8G055700_v2.0.a1 Prupe.8G055700_v2.0.a1 Prupe.8G055700_v2.0.a1 Prupe.8G055700_v2.0.a1
pyrus_communis	pycom05g03340 pycom05g03350 pycom10g03310
rosa_chinensis	RchiOBHm_Chr6g0272141
rosa_laevigata	RLG00000013698
rosa_multiflora	Rmu_co7960774.1_g000001 Rmu_sc0004606.1_g000001 Rmu_sc0008168.1_g000006 Rmu_sc0013301.1_g000010 Rmu_sc0027055.1_g000001
rosa_roxburghii	Rroxscaffold_7G00196560
rosa_rugosa	Rorug06G0066000
rosa_samantha	Rh6AG183200 Rh6BG183900 Rh6CG184500 Rh6DG176200
rosa_wichuraiana	Rw6G015770

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	59
AclWI	GGATC	1 cut(s)	215
AcoI	YGGCCR	1 cut(s)	25
AfeI	AGCGCT	1 cut(s)	173
AflII	CTTAAG	1 cut(s)	191
AjnI	CCWGG	1 cut(s)	156
AluBI	AGCT	1 cut(s)	50
AluI	AGCT	1 cut(s)	50
Alw26I	GTCTC	1 cut(s)	105
AlwI	GGATC	1 cut(s)	215
Aor51HI	AGCGCT	1 cut(s)	173
AoxI	GGCC	1 cut(s)	25
Asp700I	GAANNNNTTC	1 cut(s)	66
AspLEI	GCGC	1 cut(s)	174
AspS9I	GGNCC	1 cut(s)	177
AsuHPI	GGTGA	1 cut(s)	103
AvaII	GGWCC	1 cut(s)	177
BalI	TGGCCA	1 cut(s)	27
BccI	CCATC	1 cut(s)	17
BciT130I	CCWGG	1 cut(s)	158
BcoDI	GTCTC	1 cut(s)	105
BfoI	RGCGCY	1 cut(s)	175
BfrI	CTTAAG	1 cut(s)	191
Bme1390I	CCNGG	1 cut(s)	158
Bme18I	GGWCC	1 cut(s)	177
BmgT120I	GGNCC	1 cut(s)	177
BmrFI	CCNGG	1 cut(s)	158
BsaJI	CCNNGG	1 cut(s)	156
BseBI	CCWGG	1 cut(s)	158
BseDI	CCNNGG	1 cut(s)	156
BseMII	CTCAG	1 cut(s)	221
BshFI	GGCC	1 cut(s)	27
BsmAI	GTCTC	1 cut(s)	105
BsmBI	CGTCTC	1 cut(s)	105
BsnI	GGCC	1 cut(s)	27
Bsp143I	GATC	1 cut(s)	220
BspACI	CCGC	1 cut(s)	59
BspANI	GGCC	1 cut(s)	27
BspCNI	CTCAG	1 cut(s)	220
BspPI	GGATC	1 cut(s)	215
BspTI	CTTAAG	1 cut(s)	191
BssECI	CCNNGG	1 cut(s)	156
BssMI	GATC	1 cut(s)	220
Bst2UI	CCWGG	1 cut(s)	158
BstAFI	CTTAAG	1 cut(s)	191
BstDEI	CTNAG	1 cut(s)	207
BstH2I	RGCGCY	1 cut(s)	175
BstHHI	GCGC	1 cut(s)	174
BstKTI	GATC	1 cut(s)	223
BstMAI	GTCTC	1 cut(s)	105
BstMBI	GATC	1 cut(s)	220
BstMWI	GCNNNNNNNGC	1 cut(s)	56
BstNI	CCWGG	1 cut(s)	158
BstSCI	CCNGG	1 cut(s)	156
BsuRI	GGCC	1 cut(s)	27
CfoI	GCGC	1 cut(s)	174
Cfr13I	GGNCC	1 cut(s)	177
CseI	GACGC	1 cut(s)	87
CviAII	CATG	2 cut(s)	29, 202
CviJI	RGCY	4 cut(s)	27, 50, 206, 240
CviKI_1	RGCY	4 cut(s)	27, 50, 206, 240
DdeI	CTNAG	1 cut(s)	207
DpnI	GATC	1 cut(s)	222
DpnII	GATC	1 cut(s)	220
DraI	TTTAAA	1 cut(s)	168
EaeI	YGGCCR	1 cut(s)	25
Eco32I	GATATC	1 cut(s)	83
Eco47I	GGWCC	1 cut(s)	177
Eco47III	AGCGCT	1 cut(s)	173
EcoRII	CCWGG	1 cut(s)	156
EcoRV	GATATC	1 cut(s)	83
Esp3I	CGTCTC	1 cut(s)	105
FaeI	CATG	2 cut(s)	32, 205
FaiI	YATR	5 cut(s)	14, 30, 47, 203, 213
FatI	CATG	2 cut(s)	28, 201
GlaI	GCGC	1 cut(s)	173
HaeII	RGCGCY	1 cut(s)	175
HaeIII	GGCC	1 cut(s)	27
HgaI	GACGC	1 cut(s)	87
HhaI	GCGC	1 cut(s)	174
Hin1II	CATG	2 cut(s)	32, 205
Hin6I	GCGC	1 cut(s)	172
HinP1I	GCGC	1 cut(s)	172
HphI	GGTGA	1 cut(s)	103
Hpy188I	TCNGA	1 cut(s)	133
Hpy188III	TCNNGA	1 cut(s)	104
HpyCH4V	TGCA	1 cut(s)	7
HpyF10VI	GCNNNNNNNGC	1 cut(s)	56
HpyF3I	CTNAG	1 cut(s)	207
Hsp92II	CATG	2 cut(s)	32, 205
HspAI	GCGC	1 cut(s)	172
Kzo9I	GATC	1 cut(s)	220
LpnPI	CCDG	4 cut(s)	117, 143, 160, 170
MalI	GATC	1 cut(s)	222
MboI	GATC	1 cut(s)	220
MboII	GAAGA	1 cut(s)	146
MfeI	CAATTG	1 cut(s)	122
MlsI	TGGCCA	1 cut(s)	27
MluCI	AATT	2 cut(s)	122, 214
MluNI	TGGCCA	1 cut(s)	27
Mox20I	TGGCCA	1 cut(s)	27
MroXI	GAANNNNTTC	1 cut(s)	66
MscI	TGGCCA	1 cut(s)	27
MseI	TTAA	3 cut(s)	117, 167, 192
Msp20I	TGGCCA	1 cut(s)	27
MspCI	CTTAAG	1 cut(s)	191
MspR9I	CCNGG	1 cut(s)	158
MunI	CAATTG	1 cut(s)	122
MvaI	CCWGG	1 cut(s)	158
MwoI	GCNNNNNNNGC	1 cut(s)	56
NdeII	GATC	1 cut(s)	220
NlaIII	CATG	2 cut(s)	32, 205
PdmI	GAANNNNTTC	1 cut(s)	66
Psp6I	CCWGG	1 cut(s)	156
PspGI	CCWGG	1 cut(s)	156
PspPI	GGNCC	1 cut(s)	177
PsrI	GAACNNNNNNTAC	2 cut(s)	54, 86
SaqAI	TTAA	3 cut(s)	117, 167, 192
Sau3AI	GATC	1 cut(s)	220
Sau96I	GGNCC	1 cut(s)	177
ScrFI	CCNGG	1 cut(s)	158
SetI	ASST	2 cut(s)	12, 52
SinI	GGWCC	1 cut(s)	177
SmlI	CTYRAG	1 cut(s)	191
SmoI	CTYRAG	1 cut(s)	191
Sse9I	AATT	2 cut(s)	122, 214
SsiI	CCGC	1 cut(s)	59
StyD4I	CCNGG	1 cut(s)	156
TasI	AATT	2 cut(s)	122, 214
Tru1I	TTAA	3 cut(s)	117, 167, 192
Tru9I	TTAA	3 cut(s)	117, 167, 192
TspDTI	ATGAA	1 cut(s)	45
TspGWI	ACGGA	1 cut(s)	213
Vha464I	CTTAAG	1 cut(s)	191
VpaK11BI	GGWCC	1 cut(s)	177
XmnI	GAANNNNTTC	1 cut(s)	66

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.